Rmu_sc0005281.1_g000011
MYB Family

RADIALIS-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005281.1
Physical Location & Seq
Forward (+)
38013 .. 38312
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005281.1_g000011.1.cds

Sequence Viewer

Length: 300 bp
atggcttctagctcaatgtcttcgcgtaactcgggttcatcttggactgccaagcagaacaaggcgttcgagaaggctctagccctttacgacaaggacacccccgaccgctggtacaatgttgccagggccgtggggaataagactcctgaggaagttaagaggcactatgaccttcttgtggcagatgtgaagcatatcgagtcaggccaagttcctttcccggattacaggacttctggtgggagtgggagtgggagtggccatggcaacatcggtcatgatgaggaaaagaggtag

Protein Analysis

99

Amino Acids

10.86

Weight (kDa)

8.02

Isoelectric Point (pI)

74.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 25
AciI CCGC 1 cut(s) 109
AcoI YGGCCR 1 cut(s) 262
AfaI GTAC 1 cut(s) 116
AfiI CCNNNNNNNGG 2 cut(s) 111, 181
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 1 cut(s) 12
AluI AGCT 1 cut(s) 12
Ama87I CYCGRG 1 cut(s) 31
AoxI GGCC 3 cut(s) 129, 208, 262
AspS9I GGNCC 1 cut(s) 129
AsuC2I CCSGG 1 cut(s) 224
AvaI CYCGRG 1 cut(s) 31
AxyI CCTNAGG 1 cut(s) 150
BalI TGGCCA 1 cut(s) 264
BbsI GAAGAC 1 cut(s) 12
BceAI ACGGC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 127
BcnI CCSGG 1 cut(s) 224
BfaI CTAG 2 cut(s) 9, 80
Bme1390I CCNGG 2 cut(s) 127, 224
BmeT110I CYCGRG 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 129
BmrFI CCNGG 2 cut(s) 127, 224
BpiI GAAGAC 1 cut(s) 12
BpuMI CCSGG 1 cut(s) 224
BsaJI CCNNGG 3 cut(s) 126, 132, 265
BsaXI ACNNNNNCTCC 4 cut(s) 238, 244, 268, 274
Bsc4I CCNNNNNNNGG 2 cut(s) 111, 181
Bse21I CCTNAGG 1 cut(s) 150
BseBI CCWGG 1 cut(s) 127
BseDI CCNNGG 3 cut(s) 126, 132, 265
BseLI CCNNNNNNNGG 2 cut(s) 111, 181
BseMII CTCAG 1 cut(s) 141
Bsh1236I CGCG 1 cut(s) 25
Bsh1285I CGRYCG 1 cut(s) 109
BshFI GGCC 3 cut(s) 131, 210, 264
BsiEI CGRYCG 1 cut(s) 109
BsiHKCI CYCGRG 1 cut(s) 31
BsiSI CCGG 1 cut(s) 224
BslI CCNNNNNNNGG 2 cut(s) 111, 181
BsnI GGCC 3 cut(s) 131, 210, 264
BsoBI CYCGRG 1 cut(s) 31
Bsp19I CCATGG 1 cut(s) 265
BspACI CCGC 1 cut(s) 109
BspANI GGCC 3 cut(s) 131, 210, 264
BspCNI CTCAG 1 cut(s) 142
BspFNI CGCG 1 cut(s) 25
BspHI TCATGA 1 cut(s) 280
BssECI CCNNGG 3 cut(s) 126, 132, 265
BssT1I CCWWGG 1 cut(s) 265
Bst2UI CCWGG 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 150
BstDSI CCRYGG 2 cut(s) 132, 265
BstFNI CGCG 1 cut(s) 25
BstMCI CGRYCG 1 cut(s) 109
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 2 cut(s) 125, 222
BstUI CGCG 1 cut(s) 25
BstV2I GAAGAC 1 cut(s) 12
BstXI CCANNNNNNTGG 1 cut(s) 133
Bsu36I CCTNAGG 1 cut(s) 150
BsuRI GGCC 3 cut(s) 131, 210, 264
BtgI CCRYGG 2 cut(s) 132, 265
CciI TCATGA 1 cut(s) 280
Cfr13I GGNCC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 115
CviAII CATG 2 cut(s) 266, 281
CviJI RGCY 7 cut(s) 5, 12, 77, 83, 131, 210, 264
CviKI_1 RGCY 7 cut(s) 5, 12, 77, 83, 131, 210, 264
CviQI GTAC 1 cut(s) 115
DdeI CTNAG 1 cut(s) 150
EaeI YGGCCR 1 cut(s) 262
Eco130I CCWWGG 1 cut(s) 265
Eco81I CCTNAGG 1 cut(s) 150
Eco88I CYCGRG 1 cut(s) 31
EcoRII CCWGG 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 265
ErhI CCWWGG 1 cut(s) 265
FaeI CATG 2 cut(s) 269, 284
FaiI YATR 4 cut(s) 171, 198, 267, 282
FatI CATG 2 cut(s) 265, 280
FspBI CTAG 2 cut(s) 9, 80
HaeIII GGCC 3 cut(s) 131, 210, 264
HapII CCGG 1 cut(s) 224
Hin1II CATG 2 cut(s) 269, 284
HinfI GANTC 2 cut(s) 145, 203
HpaII CCGG 1 cut(s) 224
Hpy188III TCNNGA 3 cut(s) 70, 149, 281
HpyAV CCTTC 2 cut(s) 67, 185
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 2 cut(s) 269, 284
LpnPI CCDG 8 cut(s) 97, 112, 139, 162, 192, 217, 225, 237
MaeI CTAG 2 cut(s) 9, 80
MaeIII GTNAC 1 cut(s) 26
MboII GAAGA 1 cut(s) 12
MlsI TGGCCA 1 cut(s) 264
MluNI TGGCCA 1 cut(s) 264
MlyI GAGTC 2 cut(s) 139, 212
MnlI CCTC 4 cut(s) 145, 156, 280, 288
Mox20I TGGCCA 1 cut(s) 264
MscI TGGCCA 1 cut(s) 264
MseI TTAA 1 cut(s) 159
Msp20I TGGCCA 1 cut(s) 264
MspA1I CMGCKG 1 cut(s) 111
MspI CCGG 1 cut(s) 224
MspR9I CCNGG 2 cut(s) 127, 224
MvaI CCWGG 1 cut(s) 127
MvnI CGCG 1 cut(s) 25
NciI CCSGG 1 cut(s) 224
NcoI CCATGG 1 cut(s) 265
NlaIII CATG 2 cut(s) 269, 284
PagI TCATGA 1 cut(s) 280
PfoI TCCNGGA 1 cut(s) 222
PleI GAGTC 2 cut(s) 139, 211
PpsI GAGTC 2 cut(s) 139, 211
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PspPI GGNCC 1 cut(s) 129
PsrI GAACNNNNNNTAC 2 cut(s) 19, 51
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
SaqAI TTAA 1 cut(s) 159
Sau96I GGNCC 1 cut(s) 129
SchI GAGTC 2 cut(s) 139, 212
ScrFI CCNGG 2 cut(s) 127, 224
SetI ASST 3 cut(s) 14, 177, 299
SsiI CCGC 1 cut(s) 109
SspMI CTAG 2 cut(s) 9, 80
StyD4I CCNGG 2 cut(s) 125, 222
StyI CCWWGG 1 cut(s) 265
TaqI TCGA 2 cut(s) 69, 201
TaqII GACCGA 1 cut(s) 266
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TspDTI ATGAA 1 cut(s) 27
XspI CTAG 2 cut(s) 9, 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.