Rh6BG130500
MYB Family

RADIALIS-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
20281953 .. 20283228
1276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG130500.1

Sequence Viewer

Length: 321 bp
ATGGCTTCTAGCTCAATGTCTTCTCGTAACTCGGGTTCATCTTGGACTGCCAAGCAGAACAAGGCATTCGAGAAGGCTCTAGCCCTTTACGACAAGGACACCCCCGACCGATGGTACAATGTTGCCAGGGCCGTGGGGAATAAGACTCCCGAGGAAGTTAAGAGGCACTATGACCTTCTTGTGGCAGATGTGAAGCATATCGAGTCCGGCCAAGTTCCTTTCCCGGATTACAGGACTTCTGGTGGGAGTGGGAGTGGGAGTGGCCATGGCAACATCGGTCATGATGAGGAAAAGAGGATGAGGAGCATGAAGCTGAACTGA

Protein Analysis

106

Amino Acids

11.72

Weight (kDa)

9.26

Isoelectric Point (pI)

72.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 14 - 57 1.8e-06 Myb-like DNA-binding domain
Myb_DNA-binding_2 PF23082 14 - 57 4.6e-06 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 208, 262
AfaI GTAC 1 cut(s) 116
AfiI CCNNNNNNNGG 2 cut(s) 111, 181
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 2 cut(s) 12, 313
AluI AGCT 2 cut(s) 12, 313
Ama87I CYCGRG 2 cut(s) 31, 149
AoxI GGCC 3 cut(s) 129, 208, 262
AspS9I GGNCC 1 cut(s) 129
AsuC2I CCSGG 1 cut(s) 224
AvaI CYCGRG 2 cut(s) 31, 149
BalI TGGCCA 1 cut(s) 264
BbsI GAAGAC 1 cut(s) 12
BccI CCATC 1 cut(s) 105
BceAI ACGGC 1 cut(s) 116
BciT130I CCWGG 1 cut(s) 127
BcnI CCSGG 1 cut(s) 224
BfaI CTAG 2 cut(s) 9, 80
Bme1390I CCNGG 2 cut(s) 127, 224
BmeT110I CYCGRG 2 cut(s) 31, 149
BmgT120I GGNCC 1 cut(s) 129
BmrFI CCNGG 2 cut(s) 127, 224
BpiI GAAGAC 1 cut(s) 12
BpuMI CCSGG 1 cut(s) 224
BsaJI CCNNGG 4 cut(s) 126, 132, 150, 265
BsaXI ACNNNNNCTCC 4 cut(s) 238, 244, 268, 274
Bsc4I CCNNNNNNNGG 2 cut(s) 111, 181
BseBI CCWGG 1 cut(s) 127
BseDI CCNNGG 4 cut(s) 126, 132, 150, 265
BseGI GGATG 1 cut(s) 303
BseLI CCNNNNNNNGG 2 cut(s) 111, 181
BseRI GAGGAG 1 cut(s) 316
Bsh1285I CGRYCG 1 cut(s) 109
BshFI GGCC 3 cut(s) 131, 210, 264
BsiEI CGRYCG 1 cut(s) 109
BsiHKCI CYCGRG 2 cut(s) 31, 149
BsiSI CCGG 2 cut(s) 207, 224
BslI CCNNNNNNNGG 2 cut(s) 111, 181
BsmI GAATGC 1 cut(s) 65
BsnI GGCC 3 cut(s) 131, 210, 264
BsoBI CYCGRG 2 cut(s) 31, 149
Bsp19I CCATGG 1 cut(s) 265
BspANI GGCC 3 cut(s) 131, 210, 264
BspHI TCATGA 1 cut(s) 280
BssECI CCNNGG 4 cut(s) 126, 132, 150, 265
BssT1I CCWWGG 1 cut(s) 265
Bst2UI CCWGG 1 cut(s) 127
BstDSI CCRYGG 2 cut(s) 132, 265
BstF5I GGATG 1 cut(s) 303
BstMCI CGRYCG 1 cut(s) 109
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 2 cut(s) 125, 222
BstV2I GAAGAC 1 cut(s) 12
BstXI CCANNNNNNTGG 1 cut(s) 133
BsuRI GGCC 3 cut(s) 131, 210, 264
BtgI CCRYGG 2 cut(s) 132, 265
BtsCI GGATG 1 cut(s) 303
CciI TCATGA 1 cut(s) 280
Cfr13I GGNCC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 115
CviAII CATG 3 cut(s) 266, 281, 307
CviJI RGCY 8 cut(s) 5, 12, 77, 83, 131, 210, 264, 313
CviKI_1 RGCY 8 cut(s) 5, 12, 77, 83, 131, 210, 264, 313
CviQI GTAC 1 cut(s) 115
EaeI YGGCCR 2 cut(s) 208, 262
Eco130I CCWWGG 1 cut(s) 265
Eco88I CYCGRG 2 cut(s) 31, 149
EcoRII CCWGG 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 265
ErhI CCWWGG 1 cut(s) 265
FaeI CATG 3 cut(s) 269, 284, 310
FaiI YATR 5 cut(s) 171, 198, 267, 282, 308
FatI CATG 3 cut(s) 265, 280, 306
FokI GGATG 1 cut(s) 310
FspBI CTAG 2 cut(s) 9, 80
HaeIII GGCC 3 cut(s) 131, 210, 264
HapII CCGG 2 cut(s) 207, 224
Hin1II CATG 3 cut(s) 269, 284, 310
HinfI GANTC 2 cut(s) 145, 203
HpaII CCGG 2 cut(s) 207, 224
Hpy188III TCNNGA 3 cut(s) 70, 149, 281
HpyAV CCTTC 2 cut(s) 67, 185
Hsp92II CATG 3 cut(s) 269, 284, 310
LmnI GCTCC 1 cut(s) 303
LpnPI CCDG 6 cut(s) 112, 139, 217, 220, 225, 237
MaeI CTAG 2 cut(s) 9, 80
MaeIII GTNAC 1 cut(s) 26
MboII GAAGA 1 cut(s) 12
MlsI TGGCCA 1 cut(s) 264
MluNI TGGCCA 1 cut(s) 264
MlyI GAGTC 2 cut(s) 139, 212
MnlI CCTC 5 cut(s) 145, 156, 280, 288, 294
Mox20I TGGCCA 1 cut(s) 264
MscI TGGCCA 1 cut(s) 264
MseI TTAA 1 cut(s) 159
Msp20I TGGCCA 1 cut(s) 264
MspI CCGG 2 cut(s) 207, 224
MspR9I CCNGG 2 cut(s) 127, 224
Mva1269I GAATGC 1 cut(s) 65
MvaI CCWGG 1 cut(s) 127
NciI CCSGG 1 cut(s) 224
NcoI CCATGG 1 cut(s) 265
NlaIII CATG 3 cut(s) 269, 284, 310
PagI TCATGA 1 cut(s) 280
PctI GAATGC 1 cut(s) 65
PfoI TCCNGGA 1 cut(s) 222
PleI GAGTC 2 cut(s) 139, 211
PpsI GAGTC 2 cut(s) 139, 211
Psp6I CCWGG 1 cut(s) 125
PspGI CCWGG 1 cut(s) 125
PspPI GGNCC 1 cut(s) 129
PsrI GAACNNNNNNTAC 2 cut(s) 19, 51
RsaI GTAC 1 cut(s) 116
RsaNI GTAC 1 cut(s) 115
SaqAI TTAA 1 cut(s) 159
Sau96I GGNCC 1 cut(s) 129
SchI GAGTC 2 cut(s) 139, 212
ScrFI CCNGG 2 cut(s) 127, 224
SetI ASST 3 cut(s) 14, 177, 315
SspMI CTAG 2 cut(s) 9, 80
StyD4I CCNGG 2 cut(s) 125, 222
StyI CCWWGG 1 cut(s) 265
TaqI TCGA 2 cut(s) 69, 201
TaqII GACCGA 2 cut(s) 123, 266
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TspDTI ATGAA 1 cut(s) 27
XspI CTAG 2 cut(s) 9, 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.