Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005363.1

Orthogroup ID

OG0004012

Physical Location & Seq

Genomic Coordinates Reverse (-)

191204 .. 194541

Gene Structure 3338 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005363.1_g000051.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1941 bp

atgatcaatgacaccctcaacactgctgcaaagcttcagatggccatgattgtgacagaagtttacctctcggggcttccgaaggacactccatttcaaaattttgaacttaggtttaaggagtggggctttgagaagggttggggagacacagcagagagatccaaggaaacaatgagaatactatcagaagtactacaagctccagatccacttaacatggagaggtttttgagcaggcttcctaccatattcaatgttgtaatattctctcctcatggctattttggccaagctgatgttcttggtttgccagacaccggtggacaggttgtttatattcttgatcaagttaaagctctggaagaagaattgctccttagaattaagcaacaagggcttgctgtgaagcctcagatttttgtggtaacaagactcattcctgaagcaaggggaactacgtgcaatcaggagttggaaccgatcaatggcaccaagtactcaaacattcttagggttccatttaggacagaaaagggggtccttcgtcgttgggtttctcgttttgatatctacccctatcttgagctgtttgtgcaggatgctacagccaaaatcctcgacctcatggacgggaagcctgatcttattattggaaattacactgatgggaatttggtggcctctctgatggctaacaaacttggaataactcaggcaacaattgcacatgctttggagaagaccaagtatgaagactcagacatcaagtggaaggaattagaccctaagtatcacttctcatgccaatttctagcagacacaatttcaatgaatgcaacagattttgtcattgcaagcacattccaggaaattgcaggaagccaagacagaccaggacaatatgaaagccataccgcatttactctcccagggctttgtagagttgtttcaggcatcaatgtattcgatcccaaatttaacattgctgcacctggggctgaccagtctgtctattttccttacactgagaaacaaaaaagagtctcatcatttcatcctgccattgaagaactactgtatagcaaggaggataacaatgaacatgtggggtttctagtggataggaagaaacctatcatcttctcaatggcaaggcttgacactgttaagaacattactggtttagttgaatggtatggcaaaaacaagaggctcagaaatctggttaaccttgtagtagttggaggcttctttgacccttcaaaatcaaaagatagagaggaaatagcagaaattaaaaagatgcattcactgatagagaagtaccagctccagggtcagatcagatggatagcagcacagactgataggaaccgcaatggagaactctaccgttgtattgcggacaccaggggagcttttgtccaacctgctctatatgaagcttttggtcttactgtcattgaggcaatgaactgtggtttacccacttttgcaaccaaccaaggagggccagctgaaatcattgttgatgggatctctggtttccatattgatcccaacaatggtgatgatgcaagcagcaaaattgccgatttctttgagaaatgcaaaactgaggctacatactgggacaattattcaaaagcgggtttgcaacgcatttatgaatgctacacttggaagatatatgcaaacaaggtgttgaacatgggctgcacttatacattctggaggcagttgaacaaagagcagaaacaggcaaagcaaagatacatccagatgttctttaatctccaatatagaaatttggtgaagaatgtgcctatcccaagtgacgagcctgaaaaaccagcaccaaagccagtcaccaaatcacagacgactctaagcactagacgctcacagtcccgattgcaaaggttgtttggagcctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005618 GO:0005623 GO:0008150 GO:0008194 GO:0016157 GO:0016740 GO:0016757 GO:0016758 GO:0030312 GO:0033036 GO:0033037 GO:0035251 GO:0044464 GO:0046527 GO:0051179 GO:0052545 GO:0071944 GO:0080165

KEGG Pathways

Metabolic & Signaling

ko00500 ko01100 map00500 map01100

Pfam Domains

Protein Families

Glycos_transf_1 Sucrose_synth

Protein Analysis

646

Amino Acids

73.5

Weight (kDa)

8.18

Isoelectric Point (pI)

40.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004012)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G37180 AT5G37180 AT5G37180
fragaria_vesca	FvH4_1g27400 FvH4_1g27400 FvH4_1g27400 FvH4_1g27400 FvH4_1g27400 FvH4_1g27400
malus_domestica	MD09G1280200.v1.1 MD17G1286900.v1.1 MD17G1287000.v1.1
prunus_persica	Prupe.3G014100_v2.0.a1 Prupe.3G014100_v2.0.a1 Prupe.3G014100_v2.0.a1
pyrus_communis	pycom09g18830 pycom17g27030 pycom17g27040
rosa_chinensis	RchiOBHm_Chr3g0488651
rosa_laevigata	RLG00000022933
rosa_multiflora	Rmu_sc0005363.1_g000051
rosa_roxburghii	Rroxscaffold_6G00393980
rosa_rugosa	Rorug03G0240100 Rorug03G0240100 Rorug03G0240200 Rorug03G0240200 Rorug03G0240200 Rorug03G0240200
rosa_samantha	Rh3AG288800 Rh3BG325400 Rh3CG323100 Rh3DG321800
rosa_wichuraiana	Rw3G025570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1010
Acc36I	ACCTGC	1 cut(s)	1441
AccB1I	GGYRCC	1 cut(s)	491
AciI	CCGC	4 cut(s)	918, 1378, 1406, 1652
AclWI	GGATC	5 cut(s)	156, 203, 965, 1547, 1553
AcoI	YGGCCR	2 cut(s)	42, 289
AcsI	RAATTY	4 cut(s)	100, 673, 977, 1810
AcuI	CTGAAG	2 cut(s)	20, 465
AfaI	GTAC	3 cut(s)	195, 500, 1328
AfiI	CCNNNNNNNGG	4 cut(s)	320, 488, 1336, 1568
AflIII	ACRYGT	1 cut(s)	1105
AgeI	ACCGGT	1 cut(s)	320
AjnI	CCWGG	6 cut(s)	867, 895, 931, 994, 1335, 1412
AjuI	GAANNNNNNNTTGG	2 cut(s)	285, 317
AluBI	AGCT	9 cut(s)	34, 203, 296, 359, 589, 1333, 1421, 1448, 1520
AluI	AGCT	9 cut(s)	34, 203, 296, 359, 589, 1333, 1421, 1448, 1520
Alw26I	GTCTC	2 cut(s)	141, 1051
AlwI	GGATC	5 cut(s)	156, 203, 965, 1547, 1553
Ama87I	CYCGRG	1 cut(s)	70
AoxI	GGCC	4 cut(s)	42, 289, 681, 1514
ApeKI	GCWGC	5 cut(s)	26, 989, 1358, 1584, 1719
ApoI	RAATTY	4 cut(s)	100, 673, 977, 1810
AsiGI	ACCGGT	1 cut(s)	320
AspS9I	GGNCC	2 cut(s)	541, 1514
AsuHPI	GGTGA	3 cut(s)	1583, 1828, 1864
AvaI	CYCGRG	1 cut(s)	70
AvaII	GGWCC	1 cut(s)	541
BalI	TGGCCA	2 cut(s)	44, 291
BanI	GGYRCC	1 cut(s)	491
BbsI	GAAGAC	2 cut(s)	749, 762
BbvI	GCAGC	5 cut(s)	13, 976, 1370, 1596, 1706
BccI	CCATC	5 cut(s)	34, 662, 685, 1344, 1529
BciT130I	CCWGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
BclI	TGATCA	2 cut(s)	3, 346
BcoDI	GTCTC	2 cut(s)	141, 1051
BfaI	CTAG	3 cut(s)	815, 1118, 1899
BfmI	CTRYAG	1 cut(s)	606
BfuAI	ACCTGC	1 cut(s)	1441
BisI	GCNGC	5 cut(s)	27, 990, 1359, 1585, 1720
BlsI	GCNGC	5 cut(s)	28, 991, 1360, 1586, 1721
BmcAI	AGTACT	2 cut(s)	195, 500
Bme1390I	CCNGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
Bme18I	GGWCC	1 cut(s)	541
BmeT110I	CYCGRG	1 cut(s)	70
BmgT120I	GGNCC	2 cut(s)	541, 1514
BmiI	GGNNCC	6 cut(s)	480, 493, 519, 542, 1376, 1936
BmrFI	CCNGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
BmrI	ACTGGG	1 cut(s)	1642
BmsI	GCATC	4 cut(s)	592, 966, 1296, 1567
BmuI	ACTGGG	1 cut(s)	1642
BpiI	GAAGAC	2 cut(s)	749, 762
BpmI	CTGGAG	3 cut(s)	189, 1319, 1756
BpuEI	CTTGAG	1 cut(s)	605
BsaAI	YACGTR	1 cut(s)	462
BsaJI	CCNNGG	7 cut(s)	165, 931, 932, 995, 1336, 1413, 1507
BsaWI	WCCGGW	1 cut(s)	320
BsaXI	ACNNNNNCTCC	2 cut(s)	1410, 1440
Bsc4I	CCNNNNNNNGG	4 cut(s)	320, 488, 1336, 1568
Bse118I	RCCGGY	1 cut(s)	320
Bse1I	ACTGG	4 cut(s)	1006, 1186, 1637, 1868
Bse3DI	GCAATG	4 cut(s)	852, 984, 1387, 1479
BseBI	CCWGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
BseDI	CCNNGG	7 cut(s)	165, 931, 932, 995, 1336, 1413, 1507
BseGI	GGATG	3 cut(s)	607, 1057, 1779
BseLI	CCNNNNNNNGG	4 cut(s)	320, 488, 1336, 1568
BseMI	GCAATG	4 cut(s)	852, 984, 1387, 1479
BseMII	CTCAG	6 cut(s)	428, 728, 774, 1020, 1231, 1611
BseNI	ACTGG	4 cut(s)	1006, 1186, 1637, 1868
BseRI	GAGGAG	1 cut(s)	264
BseXI	GCAGC	5 cut(s)	13, 976, 1370, 1596, 1706
BsgI	GTGCAG	3 cut(s)	617, 975, 1705
BshFI	GGCC	4 cut(s)	44, 291, 683, 1516
BshNI	GGYRCC	1 cut(s)	491
BshTI	ACCGGT	1 cut(s)	320
BsiHKCI	CYCGRG	1 cut(s)	70
BsiSI	CCGG	1 cut(s)	321
BslFI	GGGAC	2 cut(s)	1649, 1897
BslI	CCNNNNNNNGG	4 cut(s)	320, 488, 1336, 1568
BsmAI	GTCTC	2 cut(s)	141, 1051
BsmFI	GGGAC	2 cut(s)	1649, 1897
BsmI	GAATGC	3 cut(s)	841, 1309, 1679
BsnI	GGCC	4 cut(s)	44, 291, 683, 1516
BsoBI	CYCGRG	1 cut(s)	70
BspACI	CCGC	4 cut(s)	918, 1378, 1406, 1652
BspANI	GGCC	4 cut(s)	44, 291, 683, 1516
BspCNI	CTCAG	6 cut(s)	427, 727, 773, 1021, 1230, 1612
BspLI	GGNNCC	6 cut(s)	480, 493, 519, 542, 1376, 1936
BspMI	ACCTGC	1 cut(s)	1441
BspPI	GGATC	5 cut(s)	156, 203, 965, 1547, 1553
BspT107I	GGYRCC	1 cut(s)	491
BsrDI	GCAATG	4 cut(s)	852, 984, 1387, 1479
BsrFI	RCCGGY	1 cut(s)	320
BsrI	ACTGG	4 cut(s)	1006, 1186, 1637, 1868
BssAI	RCCGGY	1 cut(s)	320
BssECI	CCNNGG	7 cut(s)	165, 931, 932, 995, 1336, 1413, 1507
BssT1I	CCWWGG	2 cut(s)	165, 1507
Bst2UI	CCWGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
Bst4CI	ACNGT	6 cut(s)	1080, 1168, 1397, 1462, 1481, 1911
BstAPI	GCANNNNNTGC	1 cut(s)	725
BstBAI	YACGTR	1 cut(s)	462
BstC8I	GCNNGC	5 cut(s)	239, 402, 859, 1518, 1582
BstF5I	GGATG	3 cut(s)	607, 1057, 1779
BstMAI	GTCTC	2 cut(s)	141, 1051
BstMWI	GCNNNNNNNGC	6 cut(s)	288, 397, 595, 725, 998, 1902
BstNI	CCWGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
BstNSI	RCATGY	2 cut(s)	734, 1109
BstSCI	CCNGG	6 cut(s)	867, 895, 931, 994, 1335, 1412
BstSFI	CTRYAG	1 cut(s)	606
BstV1I	GCAGC	5 cut(s)	13, 976, 1370, 1596, 1706
BstV2I	GAAGAC	2 cut(s)	749, 762
BstX2I	RGATCY	3 cut(s)	161, 208, 1539
BstYI	RGATCY	3 cut(s)	161, 208, 1539
BsuRI	GGCC	4 cut(s)	44, 291, 683, 1516
BtsCI	GGATG	3 cut(s)	607, 1057, 1779
BtsI	GCAGTG	1 cut(s)	21
BtsIMutI	CAGTG	5 cut(s)	21, 663, 1026, 1164, 1313
BveI	ACCTGC	1 cut(s)	1441
Cac8I	GCNNGC	5 cut(s)	239, 402, 859, 1518, 1582
Cfr10I	RCCGGY	1 cut(s)	320
Cfr13I	GGNCC	2 cut(s)	541, 1514
CseI	GACGC	1 cut(s)	1911
Csp6I	GTAC	3 cut(s)	194, 499, 1327
CspAI	ACCGGT	1 cut(s)	320
CviAII	CATG	8 cut(s)	46, 220, 278, 628, 731, 804, 1106, 1714
CviQI	GTAC	3 cut(s)	194, 499, 1327
DrdI	GACNNNNNNGTC	1 cut(s)	1010
DseDI	GACNNNNNNGTC	1 cut(s)	1010
EaeI	YGGCCR	2 cut(s)	42, 289
Eco130I	CCWWGG	2 cut(s)	165, 1507
Eco32I	GATATC	1 cut(s)	571
Eco47I	GGWCC	1 cut(s)	541
Eco57I	CTGAAG	2 cut(s)	20, 465
Eco88I	CYCGRG	1 cut(s)	70
EcoO109I	RGGNCCY	1 cut(s)	541
EcoRII	CCWGG	6 cut(s)	867, 895, 931, 994, 1335, 1412
EcoRV	GATATC	1 cut(s)	571
EcoT14I	CCWWGG	2 cut(s)	165, 1507
EcoT22I	ATGCAT	1 cut(s)	1311
ErhI	CCWWGG	2 cut(s)	165, 1507
FaeI	CATG	8 cut(s)	49, 223, 281, 631, 734, 807, 1109, 1717
FalI	AAGNNNNNCTT	2 cut(s)	782, 814
FaqI	GGGAC	2 cut(s)	1649, 1897
FatI	CATG	8 cut(s)	45, 219, 277, 627, 730, 803, 1105, 1713
FauI	CCCGC	1 cut(s)	1645
FbaI	TGATCA	2 cut(s)	3, 346
Fnu4HI	GCNGC	5 cut(s)	27, 990, 1359, 1585, 1720
FokI	GGATG	3 cut(s)	614, 1044, 1766
Fsp4HI	GCNGC	5 cut(s)	27, 990, 1359, 1585, 1720
FspBI	CTAG	3 cut(s)	815, 1118, 1899
GluI	GCNGC	5 cut(s)	27, 990, 1359, 1585, 1720
GsuI	CTGGAG	3 cut(s)	189, 1319, 1756
HaeIII	GGCC	4 cut(s)	44, 291, 683, 1516
HapII	CCGG	1 cut(s)	321
HgaI	GACGC	1 cut(s)	1911
Hin1II	CATG	8 cut(s)	49, 223, 281, 631, 734, 807, 1109, 1717
HincII	GTYRAC	1 cut(s)	1231
HindII	GTYRAC	1 cut(s)	1231
HindIII	AAGCTT	2 cut(s)	32, 1446
HinfI	GANTC	4 cut(s)	435, 758, 1044, 1888
HpaI	GTTAAC	1 cut(s)	1231
HpaII	CCGG	1 cut(s)	321
HphI	GGTGA	3 cut(s)	1583, 1828, 1864
Hpy166II	GTNNAC	4 cut(s)	64, 326, 1231, 1487
Hpy188I	TCNGA	9 cut(s)	39, 81, 190, 417, 690, 763, 1220, 1344, 1349
Hpy188III	TCNNGA	9 cut(s)	206, 344, 362, 443, 470, 584, 1735, 1783, 1914
Hpy8I	GTNNAC	4 cut(s)	64, 326, 1231, 1487
Hpy99I	CGWCG	1 cut(s)	552
HpyAV	CCTTC	5 cut(s)	76, 130, 554, 769, 1272
HpyCH4III	ACNGT	6 cut(s)	1080, 1168, 1397, 1462, 1481, 1911
HpyCH4IV	ACGT	1 cut(s)	461
HpyF10VI	GCNNNNNNNGC	6 cut(s)	288, 397, 595, 725, 998, 1902
HpySE526I	ACGT	1 cut(s)	461
Hsp92II	CATG	8 cut(s)	49, 223, 281, 631, 734, 807, 1109, 1717
Ksp22I	TGATCA	2 cut(s)	3, 346
KspAI	GTTAAC	1 cut(s)	1231
LmnI	GCTCC	5 cut(s)	208, 381, 1338, 1418, 1934
Lsp1109I	GCAGC	5 cut(s)	13, 976, 1370, 1596, 1706
LweI	GCATC	4 cut(s)	592, 966, 1296, 1567
MaeI	CTAG	3 cut(s)	815, 1118, 1899
MaeII	ACGT	1 cut(s)	461
MaeIII	GTNAC	4 cut(s)	52, 427, 1838, 1870
MboII	GAAGA	9 cut(s)	377, 380, 754, 767, 1082, 1135, 1141, 1699, 1831
MfeI	CAATTG	1 cut(s)	723
MflI	RGATCY	3 cut(s)	161, 208, 1539
MlsI	TGGCCA	2 cut(s)	44, 291
MluNI	TGGCCA	2 cut(s)	44, 291
MlyI	GAGTC	4 cut(s)	429, 752, 1053, 1882
MmeI	TCCRAC	3 cut(s)	456, 1225, 1453
Mox20I	TGGCCA	2 cut(s)	44, 291
Mph1103I	ATGCAT	1 cut(s)	1311
MscI	TGGCCA	2 cut(s)	44, 291
MseI	TTAA	9 cut(s)	117, 216, 354, 387, 981, 1170, 1230, 1299, 1794
MslI	CAYNNNNRTG	2 cut(s)	50, 1784
Msp20I	TGGCCA	2 cut(s)	44, 291
MspA1I	CMGCKG	1 cut(s)	1520
MspI	CCGG	1 cut(s)	321
MspR9I	CCNGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
MunI	CAATTG	1 cut(s)	723
Mva1269I	GAATGC	3 cut(s)	841, 1309, 1679
MvaI	CCWGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
MwoI	GCNNNNNNNGC	6 cut(s)	288, 397, 595, 725, 998, 1902
NlaIII	CATG	8 cut(s)	49, 223, 281, 631, 734, 807, 1109, 1717
NlaIV	GGNNCC	6 cut(s)	480, 493, 519, 542, 1376, 1936
NmuCI	GTSAC	3 cut(s)	52, 1838, 1870
NsiI	ATGCAT	1 cut(s)	1311
NspI	RCATGY	2 cut(s)	734, 1109
PasI	CCCWGGG	1 cut(s)	932
PciI	ACATGT	1 cut(s)	1105
PcsI	WCGNNNNNNNCGW	1 cut(s)	77
PctI	GAATGC	3 cut(s)	841, 1309, 1679
PfoI	TCCNGGA	1 cut(s)	867
PinAI	ACCGGT	1 cut(s)	320
PkrI	GCNGC	5 cut(s)	28, 991, 1360, 1586, 1721
PleI	GAGTC	4 cut(s)	429, 752, 1052, 1882
PpsI	GAGTC	4 cut(s)	429, 752, 1052, 1882
Ppu21I	YACGTR	1 cut(s)	462
PpuMI	RGGWCCY	1 cut(s)	541
PscI	ACATGT	1 cut(s)	1105
Psp5II	RGGWCCY	1 cut(s)	541
Psp6I	CCWGG	6 cut(s)	867, 895, 931, 994, 1335, 1412
PspGI	CCWGG	6 cut(s)	867, 895, 931, 994, 1335, 1412
PspN4I	GGNNCC	6 cut(s)	480, 493, 519, 542, 1376, 1936
PspPI	GGNCC	2 cut(s)	541, 1514
PspPPI	RGGWCCY	1 cut(s)	541
PsuI	RGATCY	3 cut(s)	161, 208, 1539
PvuII	CAGCTG	1 cut(s)	1520
RsaI	GTAC	3 cut(s)	195, 500, 1328
RsaNI	GTAC	3 cut(s)	194, 499, 1327
RseI	CAYNNNNRTG	2 cut(s)	50, 1784
SaqAI	TTAA	9 cut(s)	117, 216, 354, 387, 981, 1170, 1230, 1299, 1794
SatI	GCNGC	5 cut(s)	27, 990, 1359, 1585, 1720
Sau96I	GGNCC	2 cut(s)	541, 1514
ScaI	AGTACT	2 cut(s)	195, 500
SchI	GAGTC	4 cut(s)	429, 752, 1053, 1882
ScrFI	CCNGG	6 cut(s)	869, 897, 933, 996, 1337, 1414
SfaNI	GCATC	4 cut(s)	592, 966, 1296, 1567
SfcI	CTRYAG	1 cut(s)	606
SgrAI	CRCCGGYG	1 cut(s)	320
SinI	GGWCC	1 cut(s)	541
SmiMI	CAYNNNNRTG	2 cut(s)	50, 1784
SmlI	CTYRAG	1 cut(s)	584
SmoI	CTYRAG	1 cut(s)	584
SsiI	CCGC	4 cut(s)	918, 1378, 1406, 1652
SspI	AATATT	1 cut(s)	267
SspMI	CTAG	3 cut(s)	815, 1118, 1899
StyD4I	CCNGG	6 cut(s)	867, 895, 931, 994, 1335, 1412
StyI	CCWWGG	2 cut(s)	165, 1507
TaaI	ACNGT	6 cut(s)	1080, 1168, 1397, 1462, 1481, 1911
TaiI	ACGT	1 cut(s)	464
TaqI	TCGA	2 cut(s)	621, 969
TatI	WGTACW	2 cut(s)	193, 498
Tru1I	TTAA	9 cut(s)	117, 216, 354, 387, 981, 1170, 1230, 1299, 1794
Tru9I	TTAA	9 cut(s)	117, 216, 354, 387, 981, 1170, 1230, 1299, 1794
TscAI	CASTG	5 cut(s)	28, 670, 1033, 1171, 1320
TseFI	GTSAC	3 cut(s)	52, 1838, 1870
TseI	GCWGC	5 cut(s)	26, 989, 1358, 1584, 1719
Tsp45I	GTSAC	3 cut(s)	52, 1838, 1870
TspDTI	ATGAA	8 cut(s)	768, 848, 921, 1046, 1116, 1458, 1490, 1686
TspRI	CASTG	5 cut(s)	28, 670, 1033, 1171, 1320
VpaK11BI	GGWCC	1 cut(s)	541
XapI	RAATTY	4 cut(s)	100, 673, 977, 1810
XceI	RCATGY	2 cut(s)	734, 1109
XspI	CTAG	3 cut(s)	815, 1118, 1899
ZrmI	AGTACT	2 cut(s)	195, 500
Zsp2I	ATGCAT	1 cut(s)	1311

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.