Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005612.1

Orthogroup ID

OG0012560

Physical Location & Seq

Genomic Coordinates Reverse (-)

6068 .. 9939

Gene Structure 3872 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005612.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1323 bp

atgaacaatgaggaggaggaggaggaggctaggaataggaagaatgggggagaaggaagttcctcatcatggacagatgtggatgtaaaggaaagatcatctttggactgttacgaaaatccaccaacaaacgaaatgtttctcagttcacttggagtaattgaagatgacagcaataactctgctacaaatctgagcaactcaaaccacagcatggagagcatggctgcacagtctgctaattcatctgttgctcatgattttgagtctgatgcacaagacaatggcaacaattgcgcggccaacttctcgatcaatgatcaaatgggcctgcaatatgatttggatggtaacatggcgagatcaacatctgtttcgtccctagagccacaaaatgtgggaggcaattgttgtgaacagtctgtctttcagagactcaatggagatattgaaaccctttctccaatttctcagctgtgtcctcttcaagcttatgagggtttctcttctcctctttgtcctcctggtatgggacaacagaagctgtgcagctttggtagtaatgatatttatgagttgtctgatttagtcaccacagagaaggtaagccaggagatgggaaattatccattgccttcttttgcttctgggcctcagattccaatggcaatgactggattgcagtctttcccacagactacatcaactaacccctctgctgaatgtactggacctagaaagcctcgtatgagggcacgccgaggccaggcaactgatccacacagtattgctgaaaggcttcggagagagaaaattgctgacagaatgaagaatctgcaagaacttgtaccaaagtctaacaagactgacaaggcatctatgcttgatgaaatcatcgagtatgtcaagtttcttcagcaacaactcaaggttctaagcgcacgcagattgggagctacaggggcagttatcttggataatcaggctaaggggaccaatgggatttcacagtctccatcacttggtcaagtagctcatgacatttctttcaatgaaattgcttttgaacaagtactgaaactgatggaaaccgatgtaaccaaggcaatgcattatctccaaagcaaaggtctctgcatgatgcccgtcgctcttgccaatgccatattggccgaaaaggaatcatcaccggctcctgattctgccgagaatttgaagaactccggttttactgatgatggttttgttcacaaccccagcagcagcagtagcagtaacagcaacaccttgcctggcaccgacaaaacggctgtcaatccatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

IBR zf-C3HC4

Protein Analysis

440

Amino Acids

47.6

Weight (kDa)

4.69

Isoelectric Point (pI)

56.49

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012560)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g09520 FvH4_1g09520
malus_domestica	MD02G1103800.v1.1
prunus_persica	Prupe.7G191100_v2.0.a1 Prupe.7G191100_v2.0.a1 Prupe.7G191100_v2.0.a1 Prupe.7G191100_v2.0.a1
pyrus_communis	pycom02g08150
rosa_chinensis	RchiOBHm_Chr2g0096091
rosa_laevigata	RLG00000016624
rosa_multiflora	Rmu_sc0005612.1_g000002 Rmu_sc0005996.1_g000005
rosa_roxburghii	Rroxscaffold_2G00145760
rosa_rugosa	Rorug02G0056900
rosa_samantha	Rh2AG103900 Rh2BG106000 Rh2CG107900 Rh2DG106600
rosa_wichuraiana	Rw2G007980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	1295
AccB7I	CCANNNNNTGG	3 cut(s)	214, 616, 1022
AccII	CGCG	1 cut(s)	299
AciI	CCGC	1 cut(s)	299
AclWI	GGATC	1 cut(s)	770
AcoI	YGGCCR	2 cut(s)	300, 1170
AcsI	RAATTY	1 cut(s)	1210
AcuI	CTGAAG	1 cut(s)	899
AfaI	GTAC	3 cut(s)	727, 849, 1074
AfiI	CCNNNNNNNGG	6 cut(s)	69, 214, 530, 616, 766, 1022
AgsI	TTSAA	6 cut(s)	164, 452, 488, 1051, 1067, 1216
AjnI	CCWGG	4 cut(s)	523, 609, 765, 1291
AluBI	AGCT	6 cut(s)	475, 491, 544, 552, 956, 1034
AluI	AGCT	6 cut(s)	475, 491, 544, 552, 956, 1034
Alw26I	GTCTC	3 cut(s)	427, 1017, 1136
AlwI	GGATC	1 cut(s)	770
AlwNI	CAGNNNCTG	1 cut(s)	544
AoxI	GGCC	5 cut(s)	300, 328, 650, 763, 1170
ApeKI	GCWGC	4 cut(s)	227, 549, 1260, 1263
ApoI	RAATTY	1 cut(s)	1210
ArsI	GACNNNNNNTTYG	3 cut(s)	1114, 1146, 1296
Asp700I	GAANNNNTTC	2 cut(s)	138, 798
AspLEI	GCGC	2 cut(s)	299, 941
AspS9I	GGNCC	4 cut(s)	328, 650, 731, 993
AsuHPI	GGTGA	2 cut(s)	583, 1179
AvaII	GGWCC	2 cut(s)	731, 993
BaeGI	GKGCMC	1 cut(s)	757
BanI	GGYRCC	1 cut(s)	1295
BbvI	GCAGC	4 cut(s)	214, 561, 1272, 1275
BccI	CCATC	5 cut(s)	341, 610, 1024, 1078, 1232
BciT130I	CCWGG	4 cut(s)	525, 611, 767, 1293
BclI	TGATCA	1 cut(s)	319
BcoDI	GTCTC	3 cut(s)	427, 1017, 1136
BfaI	CTAG	3 cut(s)	30, 383, 735
BfmI	CTRYAG	1 cut(s)	957
BglI	GCCNNNNNGGC	1 cut(s)	1169
BisI	GCNGC	5 cut(s)	228, 300, 550, 1261, 1264
BlsI	GCNGC	5 cut(s)	229, 301, 551, 1262, 1265
BmcAI	AGTACT	1 cut(s)	1074
Bme1390I	CCNGG	4 cut(s)	525, 611, 767, 1293
Bme18I	GGWCC	2 cut(s)	731, 993
BmgT120I	GGNCC	4 cut(s)	328, 650, 731, 993
BmiI	GGNNCC	3 cut(s)	994, 1194, 1297
BmrFI	CCNGG	4 cut(s)	525, 611, 767, 1293
BmsI	GCATC	3 cut(s)	262, 884, 1131
BplI	GAGNNNNNCTC	2 cut(s)	488, 520
Bpu10I	CCTNAGC	1 cut(s)	987
BpuEI	CTTGAG	1 cut(s)	911
BsaBI	GATNNNNATC	1 cut(s)	367
BsaI	GGTCTC	1 cut(s)	1136
BsaJI	CCNNGG	2 cut(s)	760, 1101
BsaWI	WCCGGW	1 cut(s)	1223
BsaXI	ACNNNNNCTCC	2 cut(s)	445, 475
Bsc4I	CCNNNNNNNGG	6 cut(s)	69, 214, 530, 616, 766, 1022
Bse118I	RCCGGY	1 cut(s)	1189
Bse1I	ACTGG	2 cut(s)	679, 733
Bse3DI	GCAATG	3 cut(s)	629, 675, 1113
Bse8I	GATNNNNATC	1 cut(s)	367
BseBI	CCWGG	4 cut(s)	525, 611, 767, 1293
BseDI	CCNNGG	2 cut(s)	760, 1101
BseGI	GGATG	2 cut(s)	88, 352
BseJI	GATNNNNATC	1 cut(s)	367
BseLI	CCNNNNNNNGG	6 cut(s)	69, 214, 530, 616, 766, 1022
BseMI	GCAATG	3 cut(s)	629, 675, 1113
BseMII	CTCAG	4 cut(s)	157, 185, 485, 668
BseNI	ACTGG	2 cut(s)	679, 733
BseRI	GAGGAG	6 cut(s)	26, 29, 32, 35, 38, 501
BseSI	GKGCMC	1 cut(s)	757
BseXI	GCAGC	4 cut(s)	214, 561, 1272, 1275
BseYI	CCCAGC	1 cut(s)	1256
BsgI	GTGCAG	2 cut(s)	213, 568
Bsh1236I	CGCG	1 cut(s)	299
BshFI	GGCC	5 cut(s)	302, 330, 652, 765, 1172
BshNI	GGYRCC	1 cut(s)	1295
BsiSI	CCGG	2 cut(s)	1190, 1224
BslFI	GGGAC	3 cut(s)	364, 546, 1006
BslI	CCNNNNNNNGG	6 cut(s)	69, 214, 530, 616, 766, 1022
BsmAI	GTCTC	3 cut(s)	427, 1017, 1136
BsmFI	GGGAC	3 cut(s)	364, 546, 1006
BsnI	GGCC	5 cut(s)	302, 330, 652, 765, 1172
Bso31I	GGTCTC	1 cut(s)	1136
Bsp1286I	GDGCHC	1 cut(s)	757
Bsp143I	GATC	5 cut(s)	95, 312, 319, 362, 775
BspACI	CCGC	1 cut(s)	299
BspANI	GGCC	5 cut(s)	302, 330, 652, 765, 1172
BspCNI	CTCAG	4 cut(s)	156, 186, 484, 667
BspFNI	CGCG	1 cut(s)	299
BspHI	TCATGA	2 cut(s)	256, 1036
BspLI	GGNNCC	3 cut(s)	994, 1194, 1297
BspPI	GGATC	1 cut(s)	770
BspT107I	GGYRCC	1 cut(s)	1295
BspTNI	GGTCTC	1 cut(s)	1136
BsrDI	GCAATG	3 cut(s)	629, 675, 1113
BsrFI	RCCGGY	1 cut(s)	1189
BsrI	ACTGG	2 cut(s)	679, 733
BssAI	RCCGGY	1 cut(s)	1189
BssECI	CCNNGG	2 cut(s)	760, 1101
BssMI	GATC	5 cut(s)	95, 312, 319, 362, 775
BssT1I	CCWWGG	1 cut(s)	1101
Bst2UI	CCWGG	4 cut(s)	525, 611, 767, 1293
Bst4CI	ACNGT	5 cut(s)	110, 234, 420, 785, 1011
Bst6I	CTCTTC	2 cut(s)	489, 511
BstAPI	GCANNNNNTGC	2 cut(s)	236, 294
BstC8I	GCNNGC	3 cut(s)	332, 757, 943
BstDEI	CTNAG	6 cut(s)	143, 194, 471, 654, 935, 987
BstF5I	GGATG	2 cut(s)	88, 352
BstFNI	CGCG	1 cut(s)	299
BstHHI	GCGC	2 cut(s)	299, 941
BstKTI	GATC	5 cut(s)	98, 315, 322, 365, 778
BstMAI	GTCTC	3 cut(s)	427, 1017, 1136
BstMBI	GATC	5 cut(s)	95, 312, 319, 362, 775
BstMWI	GCNNNNNNNGC	7 cut(s)	219, 236, 294, 962, 1169, 1269, 1278
BstNI	CCWGG	4 cut(s)	525, 611, 767, 1293
BstSCI	CCNGG	4 cut(s)	523, 609, 765, 1291
BstSFI	CTRYAG	1 cut(s)	957
BstSLI	GKGCMC	1 cut(s)	757
BstUI	CGCG	1 cut(s)	299
BstV1I	GCAGC	4 cut(s)	214, 561, 1272, 1275
BsuRI	GGCC	5 cut(s)	302, 330, 652, 765, 1172
BtsCI	GGATG	2 cut(s)	88, 352
Cac8I	GCNNGC	3 cut(s)	332, 757, 943
CaiI	CAGNNNCTG	1 cut(s)	544
CciI	TCATGA	2 cut(s)	256, 1036
CfoI	GCGC	2 cut(s)	299, 941
Cfr10I	RCCGGY	1 cut(s)	1189
Cfr13I	GGNCC	4 cut(s)	328, 650, 731, 993
Csp6I	GTAC	3 cut(s)	726, 848, 1073
CviAII	CATG	8 cut(s)	69, 214, 223, 257, 355, 1037, 1138, 1320
CviQI	GTAC	3 cut(s)	726, 848, 1073
DdeI	CTNAG	6 cut(s)	143, 194, 471, 654, 935, 987
DpnI	GATC	5 cut(s)	97, 314, 321, 364, 777
DpnII	GATC	5 cut(s)	95, 312, 319, 362, 775
EaeI	YGGCCR	2 cut(s)	300, 1170
Eam1104I	CTCTTC	2 cut(s)	489, 511
EarI	CTCTTC	2 cut(s)	489, 511
Eco130I	CCWWGG	1 cut(s)	1101
Eco31I	GGTCTC	1 cut(s)	1136
Eco47I	GGWCC	2 cut(s)	731, 993
Eco57I	CTGAAG	1 cut(s)	899
EcoRII	CCWGG	4 cut(s)	523, 609, 765, 1291
EcoT14I	CCWWGG	1 cut(s)	1101
EcoT22I	ATGCAT	1 cut(s)	1113
ErhI	CCWWGG	1 cut(s)	1101
FaeI	CATG	8 cut(s)	72, 217, 226, 260, 358, 1040, 1141, 1323
FalI	AAGNNNNNCTT	2 cut(s)	85, 117
FaqI	GGGAC	3 cut(s)	364, 546, 1006
FatI	CATG	8 cut(s)	68, 213, 222, 256, 354, 1036, 1137, 1319
FbaI	TGATCA	1 cut(s)	319
Fnu4HI	GCNGC	5 cut(s)	228, 300, 550, 1261, 1264
FokI	GGATG	2 cut(s)	95, 359
Fsp4HI	GCNGC	5 cut(s)	228, 300, 550, 1261, 1264
FspBI	CTAG	3 cut(s)	30, 383, 735
GlaI	GCGC	2 cut(s)	298, 940
GluI	GCNGC	5 cut(s)	228, 300, 550, 1261, 1264
GsaI	CCCAGC	1 cut(s)	1260
HaeIII	GGCC	5 cut(s)	302, 330, 652, 765, 1172
HapII	CCGG	2 cut(s)	1190, 1224
HhaI	GCGC	2 cut(s)	299, 941
Hin1II	CATG	8 cut(s)	72, 217, 226, 260, 358, 1040, 1141, 1323
Hin6I	GCGC	2 cut(s)	297, 939
HinP1I	GCGC	2 cut(s)	297, 939
HindIII	AAGCTT	1 cut(s)	489
HinfI	GANTC	6 cut(s)	266, 435, 658, 832, 1181, 1199
HpaII	CCGG	2 cut(s)	1190, 1224
HphI	GGTGA	2 cut(s)	583, 1179
Hpy166II	GTNNAC	3 cut(s)	149, 416, 1249
Hpy188I	TCNGA	6 cut(s)	195, 271, 432, 583, 657, 804
Hpy188III	TCNNGA	4 cut(s)	257, 310, 1037, 1196
Hpy8I	GTNNAC	3 cut(s)	149, 416, 1249
Hpy99I	CGWCG	1 cut(s)	1151
HpyAV	CCTTC	3 cut(s)	47, 595, 645
HpyCH4III	ACNGT	5 cut(s)	110, 234, 420, 785, 1011
HpyCH4V	TGCA	8 cut(s)	230, 275, 334, 549, 682, 838, 1111, 1137
HpyF10VI	GCNNNNNNNGC	7 cut(s)	219, 236, 294, 962, 1169, 1269, 1278
HpyF3I	CTNAG	6 cut(s)	143, 194, 471, 654, 935, 987
Hsp92II	CATG	8 cut(s)	72, 217, 226, 260, 358, 1040, 1141, 1323
HspAI	GCGC	2 cut(s)	297, 939
Ksp22I	TGATCA	1 cut(s)	319
Kzo9I	GATC	5 cut(s)	95, 312, 319, 362, 775
LmnI	GCTCC	2 cut(s)	953, 1198
Lsp1109I	GCAGC	4 cut(s)	214, 561, 1272, 1275
LweI	GCATC	3 cut(s)	262, 884, 1131
MaeI	CTAG	3 cut(s)	30, 383, 735
MaeIII	GTNAC	5 cut(s)	110, 350, 589, 1096, 1274
MalI	GATC	5 cut(s)	97, 314, 321, 364, 777
MboI	GATC	5 cut(s)	95, 312, 319, 362, 775
MboII	GAAGA	7 cut(s)	52, 176, 476, 498, 841, 905, 1228
MfeI	CAATTG	2 cut(s)	292, 406
MhlI	GDGCHC	1 cut(s)	757
MluCI	AATT	9 cut(s)	159, 241, 292, 406, 465, 622, 813, 1056, 1210
MlyI	GAGTC	2 cut(s)	275, 429
Mph1103I	ATGCAT	1 cut(s)	1113
MroXI	GAANNNNTTC	2 cut(s)	138, 798
MspA1I	CMGCKG	1 cut(s)	475
MspI	CCGG	2 cut(s)	1190, 1224
MspR9I	CCNGG	4 cut(s)	525, 611, 767, 1293
MunI	CAATTG	2 cut(s)	292, 406
MvaI	CCWGG	4 cut(s)	525, 611, 767, 1293
MvnI	CGCG	1 cut(s)	299
MwoI	GCNNNNNNNGC	7 cut(s)	219, 236, 294, 962, 1169, 1269, 1278
NdeII	GATC	5 cut(s)	95, 312, 319, 362, 775
NlaIII	CATG	8 cut(s)	72, 217, 226, 260, 358, 1040, 1141, 1323
NlaIV	GGNNCC	3 cut(s)	994, 1194, 1297
NmeAIII	GCCGAG	2 cut(s)	785, 1231
NmuCI	GTSAC	1 cut(s)	589
NsiI	ATGCAT	1 cut(s)	1113
PagI	TCATGA	2 cut(s)	256, 1036
PdmI	GAANNNNTTC	2 cut(s)	138, 798
PfeI	GAWTC	4 cut(s)	658, 832, 1181, 1199
PflMI	CCANNNNNTGG	3 cut(s)	214, 616, 1022
PkrI	GCNGC	5 cut(s)	229, 301, 551, 1262, 1265
PleI	GAGTC	2 cut(s)	274, 429
PpsI	GAGTC	2 cut(s)	274, 429
Psp6I	CCWGG	4 cut(s)	523, 609, 765, 1291
PspFI	CCCAGC	1 cut(s)	1256
PspGI	CCWGG	4 cut(s)	523, 609, 765, 1291
PspN4I	GGNNCC	3 cut(s)	994, 1194, 1297
PspPI	GGNCC	4 cut(s)	328, 650, 731, 993
PstNI	CAGNNNCTG	1 cut(s)	544
PvuII	CAGCTG	1 cut(s)	475
RsaI	GTAC	3 cut(s)	727, 849, 1074
RsaNI	GTAC	3 cut(s)	726, 848, 1073
SatI	GCNGC	5 cut(s)	228, 300, 550, 1261, 1264
Sau3AI	GATC	5 cut(s)	95, 312, 319, 362, 775
Sau96I	GGNCC	4 cut(s)	328, 650, 731, 993
ScaI	AGTACT	1 cut(s)	1074
SchI	GAGTC	2 cut(s)	275, 429
ScrFI	CCNGG	4 cut(s)	525, 611, 767, 1293
SduI	GDGCHC	1 cut(s)	757
SfaNI	GCATC	3 cut(s)	262, 884, 1131
SfcI	CTRYAG	1 cut(s)	957
SinI	GGWCC	2 cut(s)	731, 993
SmlI	CTYRAG	1 cut(s)	926
SmoI	CTYRAG	1 cut(s)	926
Sse9I	AATT	9 cut(s)	159, 241, 292, 406, 465, 622, 813, 1056, 1210
SsiI	CCGC	1 cut(s)	299
SspMI	CTAG	3 cut(s)	30, 383, 735
StyD4I	CCNGG	4 cut(s)	523, 609, 765, 1291
StyI	CCWWGG	1 cut(s)	1101
TaaI	ACNGT	5 cut(s)	110, 234, 420, 785, 1011
TaqI	TCGA	2 cut(s)	311, 897
TasI	AATT	9 cut(s)	159, 241, 292, 406, 465, 622, 813, 1056, 1210
TatI	WGTACW	2 cut(s)	725, 1072
TauI	GCSGC	1 cut(s)	302
TfiI	GAWTC	4 cut(s)	658, 832, 1181, 1199
TseFI	GTSAC	1 cut(s)	589
TseI	GCWGC	4 cut(s)	227, 549, 1260, 1263
Tsp45I	GTSAC	1 cut(s)	589
TspDTI	ATGAA	5 cut(s)	17, 234, 842, 903, 1068
Van91I	CCANNNNNTGG	3 cut(s)	214, 616, 1022
VpaK11BI	GGWCC	2 cut(s)	731, 993
XapI	RAATTY	1 cut(s)	1210
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1165
XmnI	GAANNNNTTC	2 cut(s)	138, 798
XspI	CTAG	3 cut(s)	30, 383, 735
ZrmI	AGTACT	1 cut(s)	1074
Zsp2I	ATGCAT	1 cut(s)	1113

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.