Rmu_sc0005834.1_g000011

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005834.1
Physical Location & Seq
Reverse (-)
36640 .. 37585
946 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005834.1_g000011.1.cds

Sequence Viewer

Length: 540 bp
atgtggtctgttatggggaggtggttgttgggttggcgcagaactcgaggctcattgatgcgtctggcttttgctgacatgaaatcttgtgatgttgggtctagcatgtatagtgtttcgggtgtgctgaaggctgcagccgagcttgctgctttggagcagtgtaggatactatatgcacatgctgttgtgacggggcttgatgtgaatttagttgtagggactgctttggttgatgtctatgggaaagctgggtttgtgtctgatgctaggcaggtttttaataagaattttctggtgctaaatcttgtggatgcggtgtcatgctggcagcatgtggatgaagttgcacaagtgaggaagatgatgaaagatatgagggttgaagaaggttccggaaggagttggattgaaatgcgggggaaacttcatgtgtttttggctgggacagaagtcatcaaagaatacatgagattatgcaaagttggcagagctgatggaggggatagaaaaactaggtcatgtgccattgcaaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

179

Amino Acids

19.88

Weight (kDa)

9.45

Isoelectric Point (pI)

32.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 265
AccIII TCCGGA 1 cut(s) 395
AciI CCGC 2 cut(s) 317, 418
AcsI RAATTY 2 cut(s) 208, 289
AcuI CTGAAG 1 cut(s) 149
AgsI TTSAA 2 cut(s) 386, 413
AluBI AGCT 3 cut(s) 145, 251, 494
AluI AGCT 3 cut(s) 145, 251, 494
Ama87I CYCGRG 1 cut(s) 45
Aor13HI TCCGGA 1 cut(s) 395
ApeKI GCWGC 4 cut(s) 134, 137, 149, 331
ApoI RAATTY 2 cut(s) 208, 289
AspLEI GCGC 1 cut(s) 39
AvaI CYCGRG 1 cut(s) 45
BbvI GCAGC 4 cut(s) 121, 136, 149, 343
BccI CCATC 1 cut(s) 491
BcgI CGANNNNNNTGC 2 cut(s) 131, 165
BciVI GTATCC 1 cut(s) 162
BfaI CTAG 3 cut(s) 102, 270, 516
BfmI CTRYAG 1 cut(s) 135
BfuAI ACCTGC 1 cut(s) 265
BfuI GTATCC 1 cut(s) 162
BisI GCNGC 4 cut(s) 135, 138, 150, 332
BlsI GCNGC 4 cut(s) 136, 139, 151, 333
BmeT110I CYCGRG 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 394
BmsI GCATC 3 cut(s) 48, 256, 304
BoxI GACNNNNGTC 1 cut(s) 452
BsaWI WCCGGW 1 cut(s) 395
Bse3DI GCAATG 1 cut(s) 528
BseAI TCCGGA 1 cut(s) 395
BseGI GGATG 2 cut(s) 319, 346
BseMI GCAATG 1 cut(s) 528
BseXI GCAGC 4 cut(s) 121, 136, 149, 343
BseYI CCCAGC 2 cut(s) 251, 443
BsiHKCI CYCGRG 1 cut(s) 45
BsiSI CCGG 1 cut(s) 396
BslFI GGGAC 2 cut(s) 235, 460
BsmFI GGGAC 2 cut(s) 235, 460
BsoBI CYCGRG 1 cut(s) 45
Bsp13I TCCGGA 1 cut(s) 395
BspACI CCGC 2 cut(s) 317, 418
BspEI TCCGGA 1 cut(s) 395
BspLI GGNNCC 1 cut(s) 394
BspMAI CTGCAG 1 cut(s) 139
BspMI ACCTGC 1 cut(s) 265
BsrDI GCAATG 1 cut(s) 528
BstC8I GCNNGC 2 cut(s) 147, 329
BstF5I GGATG 2 cut(s) 319, 346
BstHHI GCGC 1 cut(s) 39
BstMWI GCNNNNNNNGC 2 cut(s) 146, 486
BstNSI RCATGY 3 cut(s) 109, 185, 338
BstPAI GACNNNNGTC 1 cut(s) 452
BstSFI CTRYAG 1 cut(s) 135
BstV1I GCAGC 4 cut(s) 121, 136, 149, 343
BsuI GTATCC 1 cut(s) 162
BtsCI GGATG 2 cut(s) 319, 346
BtsI GCAGTG 1 cut(s) 167
BtsIMutI CAGTG 1 cut(s) 167
BveI ACCTGC 1 cut(s) 265
Cac8I GCNNGC 2 cut(s) 147, 329
CfoI GCGC 1 cut(s) 39
CseI GACGC 1 cut(s) 50
CviAII CATG 8 cut(s) 79, 106, 182, 324, 335, 431, 469, 522
CviJI RGCY 9 cut(s) 51, 68, 134, 140, 145, 199, 251, 443, 494
CviKI_1 RGCY 9 cut(s) 51, 68, 134, 140, 145, 199, 251, 443, 494
Eco57I CTGAAG 1 cut(s) 149
Eco88I CYCGRG 1 cut(s) 45
FaeI CATG 8 cut(s) 82, 109, 185, 327, 338, 434, 472, 525
FaqI GGGAC 2 cut(s) 235, 460
FatI CATG 8 cut(s) 78, 105, 181, 323, 334, 430, 468, 521
FauI CCCGC 1 cut(s) 411
Fnu4HI GCNGC 4 cut(s) 135, 138, 150, 332
FokI GGATG 2 cut(s) 326, 353
Fsp4HI GCNGC 4 cut(s) 135, 138, 150, 332
FspBI CTAG 3 cut(s) 102, 270, 516
GlaI GCGC 1 cut(s) 38
GluI GCNGC 4 cut(s) 135, 138, 150, 332
GsaI CCCAGC 2 cut(s) 255, 447
HapII CCGG 1 cut(s) 396
HgaI GACGC 1 cut(s) 50
HhaI GCGC 1 cut(s) 39
Hin1II CATG 8 cut(s) 82, 109, 185, 327, 338, 434, 472, 525
Hin6I GCGC 1 cut(s) 37
HinP1I GCGC 1 cut(s) 37
HpaII CCGG 1 cut(s) 396
Hpy188I TCNGA 1 cut(s) 265
Hpy188III TCNNGA 1 cut(s) 396
HpyAV CCTTC 3 cut(s) 124, 383, 393
HpyCH4V TGCA 5 cut(s) 137, 179, 350, 480, 533
HpyF10VI GCNNNNNNNGC 2 cut(s) 146, 486
Hsp92II CATG 8 cut(s) 82, 109, 185, 327, 338, 434, 472, 525
HspAI GCGC 1 cut(s) 37
Kpn2I TCCGGA 1 cut(s) 395
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 7 cut(s) 50, 237, 260, 281, 313, 409, 429
Lsp1109I GCAGC 4 cut(s) 121, 136, 149, 343
LweI GCATC 3 cut(s) 48, 256, 304
MaeI CTAG 3 cut(s) 102, 270, 516
MaeIII GTNAC 1 cut(s) 190
MboII GAAGA 2 cut(s) 373, 398
MluCI AATT 2 cut(s) 208, 289
MmeI TCCRAC 1 cut(s) 386
MnlI CCTC 5 cut(s) 12, 41, 351, 372, 494
MroI TCCGGA 1 cut(s) 395
MseI TTAA 1 cut(s) 282
MslI CAYNNNNRTG 1 cut(s) 339
MspI CCGG 1 cut(s) 396
MwoI GCNNNNNNNGC 2 cut(s) 146, 486
NlaIII CATG 8 cut(s) 82, 109, 185, 327, 338, 434, 472, 525
NlaIV GGNNCC 1 cut(s) 394
NmeAIII GCCGAG 1 cut(s) 166
NmuCI GTSAC 1 cut(s) 190
NspI RCATGY 3 cut(s) 109, 185, 338
PaeR7I CTCGAG 1 cut(s) 45
PkrI GCNGC 4 cut(s) 136, 139, 151, 333
PshAI GACNNNNGTC 1 cut(s) 452
PspFI CCCAGC 2 cut(s) 251, 443
PspN4I GGNNCC 1 cut(s) 394
PspXI VCTCGAGB 1 cut(s) 45
PstI CTGCAG 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 339
SaqAI TTAA 1 cut(s) 282
SatI GCNGC 4 cut(s) 135, 138, 150, 332
SetI ASST 7 cut(s) 23, 147, 253, 279, 394, 496, 521
SfaNI GCATC 3 cut(s) 48, 256, 304
SfcI CTRYAG 1 cut(s) 135
Sfr274I CTCGAG 1 cut(s) 45
SlaI CTCGAG 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 339
SmlI CTYRAG 1 cut(s) 45
SmoI CTYRAG 1 cut(s) 45
Sse9I AATT 2 cut(s) 208, 289
SsiI CCGC 2 cut(s) 317, 418
SspMI CTAG 3 cut(s) 102, 270, 516
TaqI TCGA 1 cut(s) 46
TasI AATT 2 cut(s) 208, 289
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TscAI CASTG 1 cut(s) 167
TseFI GTSAC 1 cut(s) 190
TseI GCWGC 4 cut(s) 134, 137, 149, 331
Tsp45I GTSAC 1 cut(s) 190
TspDTI ATGAA 4 cut(s) 95, 357, 383, 419
TspRI CASTG 1 cut(s) 167
XapI RAATTY 2 cut(s) 208, 289
XceI RCATGY 3 cut(s) 109, 185, 338
XhoI CTCGAG 1 cut(s) 45
XspI CTAG 3 cut(s) 102, 270, 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.