Rmu_sc0005840.1_g000018

RAN GTPase-activating protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005840.1
Physical Location & Seq
Reverse (-)
60802 .. 61161
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005840.1_g000018.1.cds

Sequence Viewer

Length: 360 bp
atgggattggctagaaatgatattacagtcaaatcaactgcttctatagcttcttgtatagcaggaaagcaactcctcaccaagttaatcttgtcagagaatgaactaaaggatgaacgtgcaattctggccagcaaagcattatcaaagggtcatggtcagttaattgaggttaatttgagctctaattcaattggaaggcccagtgcaagacatttagcagaggttgttgtgaacaaacctaggttcaagtcgctgaacataaatggtgacttcatatctaatgatgaaattgatgatgtagtggatgttcttaagattttcccacatctgcttgggcctttggatgagaatgattga

Protein Analysis

119

Amino Acids

12.89

Weight (kDa)

5.89

Isoelectric Point (pI)

28.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 129
AflII CTTAAG 1 cut(s) 314
AgsI TTSAA 2 cut(s) 192, 250
AluBI AGCT 2 cut(s) 50, 183
AluI AGCT 2 cut(s) 50, 183
Alw21I GWGCWC 1 cut(s) 185
AoxI GGCC 3 cut(s) 129, 200, 338
AspA2I CCTAGG 1 cut(s) 242
AspS9I GGNCC 2 cut(s) 201, 338
AsuHPI GGTGA 2 cut(s) 70, 281
AvrII CCTAGG 1 cut(s) 242
BalI TGGCCA 1 cut(s) 131
BanII GRGCYC 1 cut(s) 185
Bbv12I GWGCWC 1 cut(s) 185
BfaI CTAG 2 cut(s) 12, 243
BfmI CTRYAG 1 cut(s) 45
BfrI CTTAAG 1 cut(s) 314
BlnI CCTAGG 1 cut(s) 242
BmgT120I GGNCC 2 cut(s) 201, 338
BmrI ACTGGG 1 cut(s) 198
BmuI ACTGGG 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 242
Bse1I ACTGG 1 cut(s) 204
BseDI CCNNGG 1 cut(s) 242
BseGI GGATG 3 cut(s) 118, 313, 352
BseNI ACTGG 1 cut(s) 204
BseRI GAGGAG 1 cut(s) 65
BshFI GGCC 3 cut(s) 131, 202, 340
BsiHKAI GWGCWC 1 cut(s) 185
BsnI GGCC 3 cut(s) 131, 202, 340
Bsp1286I GDGCHC 1 cut(s) 185
BspANI GGCC 3 cut(s) 131, 202, 340
BspTI CTTAAG 1 cut(s) 314
BsrI ACTGG 1 cut(s) 204
BssECI CCNNGG 1 cut(s) 242
BssT1I CCWWGG 1 cut(s) 242
Bst4CI ACNGT 1 cut(s) 28
BstAFI CTTAAG 1 cut(s) 314
BstC8I GCNNGC 1 cut(s) 133
BstF5I GGATG 3 cut(s) 118, 313, 352
BstMWI GCNNNNNNNGC 3 cut(s) 47, 128, 137
BstSFI CTRYAG 1 cut(s) 45
BsuRI GGCC 3 cut(s) 131, 202, 340
BtsCI GGATG 3 cut(s) 118, 313, 352
BtsIMutI CAGTG 1 cut(s) 211
Cac8I GCNNGC 1 cut(s) 133
Cfr13I GGNCC 2 cut(s) 201, 338
CviAII CATG 1 cut(s) 155
CviJI RGCY 6 cut(s) 11, 50, 131, 183, 202, 340
CviKI_1 RGCY 6 cut(s) 11, 50, 131, 183, 202, 340
EaeI YGGCCR 1 cut(s) 129
Ecl136II GAGCTC 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 242
Eco24I GRGCYC 1 cut(s) 185
Eco53kI GAGCTC 1 cut(s) 183
EcoICRI GAGCTC 1 cut(s) 183
EcoT14I CCWWGG 1 cut(s) 242
EcoT38I GRGCYC 1 cut(s) 185
ErhI CCWWGG 1 cut(s) 242
FaeI CATG 1 cut(s) 158
FaiI YATR 5 cut(s) 47, 59, 156, 263, 278
FalI AAGNNNNNCTT 2 cut(s) 74, 106
FatI CATG 1 cut(s) 154
FokI GGATG 2 cut(s) 125, 320
FriOI GRGCYC 1 cut(s) 185
FspBI CTAG 2 cut(s) 12, 243
HaeIII GGCC 3 cut(s) 131, 202, 340
Hin1II CATG 1 cut(s) 158
HphI GGTGA 2 cut(s) 70, 281
Hpy166II GTNNAC 1 cut(s) 235
Hpy188I TCNGA 1 cut(s) 97
Hpy8I GTNNAC 1 cut(s) 235
HpyAV CCTTC 1 cut(s) 192
HpyCH4III ACNGT 1 cut(s) 28
HpyCH4IV ACGT 1 cut(s) 118
HpyCH4V TGCA 2 cut(s) 122, 209
HpyF10VI GCNNNNNNNGC 3 cut(s) 47, 128, 137
HpySE526I ACGT 1 cut(s) 118
Hsp92II CATG 1 cut(s) 158
LpnPI CCDG 4 cut(s) 48, 113, 145, 217
MaeI CTAG 2 cut(s) 12, 243
MaeII ACGT 1 cut(s) 118
MaeIII GTNAC 1 cut(s) 269
MfeI CAATTG 1 cut(s) 192
MhlI GDGCHC 1 cut(s) 185
MlsI TGGCCA 1 cut(s) 131
MluCI AATT 6 cut(s) 123, 165, 175, 187, 192, 291
MluNI TGGCCA 1 cut(s) 131
MnlI CCTC 3 cut(s) 86, 163, 217
Mox20I TGGCCA 1 cut(s) 131
MscI TGGCCA 1 cut(s) 131
MseI TTAA 4 cut(s) 86, 164, 174, 315
Msp20I TGGCCA 1 cut(s) 131
MspCI CTTAAG 1 cut(s) 314
MunI CAATTG 1 cut(s) 192
MwoI GCNNNNNNNGC 3 cut(s) 47, 128, 137
NlaIII CATG 1 cut(s) 158
NmuCI GTSAC 1 cut(s) 269
Psp124BI GAGCTC 1 cut(s) 185
PspPI GGNCC 2 cut(s) 201, 338
PsrI GAACNNNNNNTAC 2 cut(s) 294, 326
SacI GAGCTC 1 cut(s) 185
SaqAI TTAA 4 cut(s) 86, 164, 174, 315
Sau96I GGNCC 2 cut(s) 201, 338
SduI GDGCHC 1 cut(s) 185
SetI ASST 7 cut(s) 52, 121, 174, 185, 228, 244, 248
SfcI CTRYAG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 314
SmoI CTYRAG 1 cut(s) 314
Sse9I AATT 6 cut(s) 123, 165, 175, 187, 192, 291
SspMI CTAG 2 cut(s) 12, 243
SstI GAGCTC 1 cut(s) 185
StyI CCWWGG 1 cut(s) 242
TaaI ACNGT 1 cut(s) 28
TaiI ACGT 1 cut(s) 121
TasI AATT 6 cut(s) 123, 165, 175, 187, 192, 291
Tru1I TTAA 4 cut(s) 86, 164, 174, 315
Tru9I TTAA 4 cut(s) 86, 164, 174, 315
TscAI CASTG 1 cut(s) 211
TseFI GTSAC 1 cut(s) 269
Tsp45I GTSAC 1 cut(s) 269
TspDTI ATGAA 4 cut(s) 117, 129, 265, 303
TspRI CASTG 1 cut(s) 211
Vha464I CTTAAG 1 cut(s) 314
XmaJI CCTAGG 1 cut(s) 242
XspI CTAG 2 cut(s) 12, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.