Rmu_sc0006263.1_g000008

N-terminal C2 in EEIG1 and EHBP1 proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006263.1
OG0003470
Physical Location & Seq
Reverse (-)
40519 .. 45591
5073 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 2958 bp
atggtgcttgggataagagcaaagagccggaagagtgctgcggttgaggtagattatgttatacatgtgctggaaattaaaccatggccctcgtctcaggctttgaaatctgttgagtctgtgtttcttcaatggggaaatggtgatcaagcgtctggatcattctttcgtaatgttggagacgagaagattgaatttggggagtcgttcaggcttccggttgttttgtacaaggagaagtcaagaaaaagctcggcgcgtgacacttaccagaagaacaacttagagtttcatctgtctgcacctcgaaaggacaaggcagctaaacttttgggatcggctgtgataaatcttgcagattatgcgaccatagttgaaactacgaatgtgagagttccactgaacttgaagaagagttctaagagttcagctcagccggttctttatattaatgttcagccttgtgattatgcgaccatagttgaaaccatgaatgtgagagttccactgaacttcaagaagagttctaagagttcagctcagccggttctttatgttaatgttcagccttgtggtaatgatagctgccacttggccaaacaagtgtcgctggacaaccatggaagtcatgggtctctggatgacgagattgcctcttttactgatgatgatggtgatgatcagtcttcacattcatcacgtactgtaacctcttctgcttttgaggcaccagtcagttcatcaccaagtgctgataagaatgcgtcagaatcaacaattgataacactagaaggatttatgaggaaccaaccgtacattcaatagcagcacctgcaaacactgttatgaatccagtcgctaatgcattgaaacatcaaagtggaagttcatctccactgttgtcaataggctcttcctcccctcggaaacctgcttatgattatatttctttgcctcacccttcaagggagagatcagtgccaaccttgaaaaaatctcaggctacaaactcaatatctgcaagctatgcagatttagaatcccttcaagatgatgatcatctcgttaaggtgaatgaatattcttttgatggcaaattagcttctaggttttcacaagatgctaccagaaagccagtcactttaaagagtgaaacttttacagtcagcaataatgttggatcacgggaaagcaaggttaaaagtactgaattaaagcatgtaaagtccatgaaaccttctatctcagctgagaccaatagtcggttaagaaaacatgagtttatgaaaaagtcaaaggaagctgagattcctgaagatggtcgtgttggtggtatcattagtgcaaagtgtgaaagagaagaaacagcaactagctgttctgatagtaaaattgagctggagtctacaattgaaatgcttaaggatgagttgagagaagcggctgctgttgaggttggcctttactccattgtcgccgagcatgggagtaacacgaataagatccatgctcctgctcgccgactttctagattctattttcatgcttgcaaaatgagatctcaagctaagaaggcaaatgcagcaagaactgctattactggattaattttggtttctaaagcttgtggaaatgatgttccaaggttgactttctggttgtcgaactcaattgtgttgagagctattgtcagccagggcttagggaaagctcaagtttcaaatggaccatgcactacaattaaaggtggcaaacagtatgcagcggataggtatttatcagcaaaggataggattcgtactcgcaatgatgagaaagataacattcttgaaagttttgataattgggaggatccacatatatttatggttgctttggaaaagtttgaagcttggatattctcccggatagttgagtctgtatggtggcagaatataactccacatatgcagtctgcagctgcgaaaggctcaagcacaaggaaagctaatggaagaaagaaaggtttgagtgatcatgagcagggtaatttttctattgagctgtggacgaaggctttcaaagatgcctgtgaaaggctctgtcctgttcgagctggtggccataagtgtggctgcttgcctcttctagctcgtttggtcatggagcagttggtgagtaggttggatgtggctatgttcaatgctattcttcgtgaaaatgctgaagagatgcccacagatcccgtgtccgaccctataagtgattccaaggttctccctattccagctggaaaatcaagttttggggcaggcgcacagctaaaaaatgcgattggaagctggtccagatggctgactgatctatttggtatggatgatactgatgttccagacgatgaggatgaactcagtgatcacaaggggcaggagagtgaaacatcctttaaagctttccgtcttctcaatgctttgagtgatctcatgatgcttccatctgaaatgcttgcagataaatccaccagagaagaggtatgccctacattcggtgcatcaatgatcaagagggtcctttacaattttgttacagatgagttttgcccagacccgattcccgaagcagtttttgaggctcttgacaatgaggagaatctggaagctgaaacagaatctgttacaagtttcccatttattgcaaatcccacattttattcaccacctccagctgctgcttctctatcaggcatgacaggagaggtggggagcccagctcacctaaggagtgggtcatcagtgcttaagaaatcatatactagtgatgatgagcttgatgagttggattcaccgatgacatcaatcgtagaaaattcccaggtttcccccaagtcgttgacagccaacccaatgctgaagtggaagggtggtcggaaagttgtccgatatcaactcctccgtcaggtttggaaggacagtgactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NT-C2

Protein Analysis

985

Amino Acids

108.37

Weight (kDa)

6.45

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NT-C2 PF10358 12 - 154 1.8e-15 N-terminal C2 in EEIG1 and EHBP1 proteins
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 841
Acc36I ACCTGC 2 cut(s) 841, 940
AccB1I GGYRCC 1 cut(s) 727
AccI GTMKAC 1 cut(s) 1406
AccII CGCG 1 cut(s) 259
AciI CCGC 3 cut(s) 41, 1442, 1766
AclWI GGATC 7 cut(s) 166, 343, 1189, 1498, 1847, 1860, 2216
AcoI YGGCCR 2 cut(s) 594, 2101
AcsI RAATTY 2 cut(s) 194, 2845
AcuI CTGAAG 3 cut(s) 1335, 2226, 2909
AdeI CACNNNGTG 1 cut(s) 749
AfaI GTAC 5 cut(s) 230, 703, 816, 1207, 1801
AfiI CCNNNNNNNGG 8 cut(s) 924, 967, 1263, 1319, 1485, 2076, 2525, 2935
AflII CTTAAG 2 cut(s) 1421, 2777
AflIII ACRYGT 1 cut(s) 64
AhdI GACNNNNNGTC 1 cut(s) 1260
AhlI ACTAGT 1 cut(s) 2792
AjnI CCWGG 2 cut(s) 1695, 2850
AjuI GAANNNNNNNTTGG 2 cut(s) 802, 834
AloI GAACNNNNNNTCC 2 cut(s) 1623, 1655
Alw26I GTCTC 4 cut(s) 99, 174, 639, 1247
AlwI GGATC 7 cut(s) 166, 343, 1189, 1498, 1847, 1860, 2216
AlwNI CAGNNNCTG 4 cut(s) 833, 2651, 2708, 2955
AoxI GGCC 4 cut(s) 86, 594, 1459, 2101
ApoI RAATTY 2 cut(s) 194, 2845
AseI ATTAAT 2 cut(s) 450, 1607
Asp700I GAANNNNTTC 2 cut(s) 1044, 2057
AspLEI GCGC 2 cut(s) 259, 2297
AspS9I GGNCC 4 cut(s) 87, 1727, 2325, 2548
AsuC2I CCSGG 1 cut(s) 1906
AsuHPI GGTGA 9 cut(s) 155, 686, 735, 950, 1084, 2167, 2685, 2744, 2814
AvaII GGWCC 3 cut(s) 1727, 2325, 2548
AxyI CCTNAGG 1 cut(s) 2756
BaeI ACNNNNGTAYC 2 cut(s) 2352, 2385
BalI TGGCCA 2 cut(s) 596, 2103
BamHI GGATCC 1 cut(s) 1852
BanI GGYRCC 1 cut(s) 727
BanII GRGCYC 1 cut(s) 2747
BbsI GAAGAC 2 cut(s) 678, 2432
BccI CCATC 5 cut(s) 665, 1085, 1313, 2325, 2482
BciT130I CCWGG 2 cut(s) 1697, 2852
BclI TGATCA 6 cut(s) 145, 679, 1057, 2014, 2395, 2538
BcnI CCSGG 1 cut(s) 1906
BcoDI GTCTC 4 cut(s) 99, 174, 639, 1247
BcuI ACTAGT 1 cut(s) 2792
BfaI CTAG 6 cut(s) 789, 1107, 1374, 1530, 2129, 2793
BfmI CTRYAG 1 cut(s) 1956
BfrI CTTAAG 2 cut(s) 1421, 2777
BfuAI ACCTGC 2 cut(s) 841, 940
BglII AGATCT 1 cut(s) 1559
BlpI GCTNAGC 2 cut(s) 432, 540
BmcAI AGTACT 1 cut(s) 1207
Bme1390I CCNGG 3 cut(s) 1697, 1906, 2852
Bme18I GGWCC 3 cut(s) 1727, 2325, 2548
BmeRI GACNNNNNGTC 1 cut(s) 1260
BmgT120I GGNCC 4 cut(s) 87, 1727, 2325, 2548
BmiI GGNNCC 5 cut(s) 729, 807, 1854, 2549, 2744
BmrFI CCNGG 3 cut(s) 1697, 1906, 2852
BmsI GCATC 5 cut(s) 1111, 2056, 2202, 2457, 2540
BpiI GAAGAC 2 cut(s) 678, 2432
BplI GAGNNNNNCTC 8 cut(s) 415, 447, 523, 555, 638, 670, 2734, 2766
BpmI CTGGAG 2 cut(s) 1421, 2685
Bpu10I CCTNAGC 1 cut(s) 1702
Bpu1102I GCTNAGC 2 cut(s) 432, 540
BpuEI CTTGAG 3 cut(s) 1548, 1698, 1957
BpuMI CCSGG 1 cut(s) 1906
BsaAI YACGTR 1 cut(s) 701
BsaBI GATNNNNATC 2 cut(s) 1056, 1059
BsaI GGTCTC 2 cut(s) 639, 1247
BsaJI CCNNGG 7 cut(s) 83, 619, 923, 1643, 1696, 2250, 2850
BsaWI WCCGGW 1 cut(s) 217
Bsc4I CCNNNNNNNGG 8 cut(s) 924, 967, 1263, 1319, 1485, 2076, 2525, 2935
Bse118I RCCGGY 2 cut(s) 436, 544
Bse1I ACTGG 4 cut(s) 731, 854, 1136, 1606
Bse21I CCTNAGG 1 cut(s) 2756
Bse3DI GCAATG 1 cut(s) 1813
Bse8I GATNNNNATC 2 cut(s) 1056, 1059
BseBI CCWGG 2 cut(s) 1697, 2852
BseDI CCNNGG 7 cut(s) 83, 619, 923, 1643, 1696, 2250, 2850
BseGI GGATG 6 cut(s) 646, 1432, 2173, 2362, 2389, 2420
BseJI GATNNNNATC 2 cut(s) 1056, 1059
BseLI CCNNNNNNNGG 8 cut(s) 924, 967, 1263, 1319, 1485, 2076, 2525, 2935
BseMI GCAATG 1 cut(s) 1813
BseMII CTCAG 8 cut(s) 110, 446, 554, 1013, 1242, 1260, 1296, 2404
BseNI ACTGG 4 cut(s) 731, 854, 1136, 1606
BseRI GAGGAG 2 cut(s) 2639, 2918
BseYI CCCAGC 1 cut(s) 2746
BsgI GTGCAG 1 cut(s) 285
Bsh1236I CGCG 1 cut(s) 259
BshFI GGCC 4 cut(s) 88, 596, 1461, 2103
BshNI GGYRCC 1 cut(s) 727
BsiSI CCGG 5 cut(s) 28, 218, 437, 545, 1906
BslI CCNNNNNNNGG 8 cut(s) 924, 967, 1263, 1319, 1485, 2076, 2525, 2935
BsmAI GTCTC 4 cut(s) 99, 174, 639, 1247
BsmBI CGTCTC 2 cut(s) 99, 174
BsmI GAATGC 1 cut(s) 766
BsnI GGCC 4 cut(s) 88, 596, 1461, 2103
Bso31I GGTCTC 2 cut(s) 639, 1247
Bsp1286I GDGCHC 1 cut(s) 2747
Bsp1407I TGTACA 1 cut(s) 228
Bsp1720I GCTNAGC 2 cut(s) 432, 540
Bsp19I CCATGG 2 cut(s) 83, 619
BspACI CCGC 3 cut(s) 41, 1442, 1766
BspANI GGCC 4 cut(s) 88, 596, 1461, 2103
BspCNI CTCAG 8 cut(s) 109, 445, 553, 1012, 1243, 1259, 1297, 2403
BspFNI CGCG 1 cut(s) 259
BspHI TCATGA 2 cut(s) 2017, 2463
BspLI GGNNCC 5 cut(s) 729, 807, 1854, 2549, 2744
BspMAI CTGCAG 1 cut(s) 1960
BspMI ACCTGC 2 cut(s) 841, 940
BspPI GGATC 7 cut(s) 166, 343, 1189, 1498, 1847, 1860, 2216
BspQI GCTCTTC 1 cut(s) 919
BspT107I GGYRCC 1 cut(s) 727
BspTI CTTAAG 2 cut(s) 1421, 2777
BspTNI GGTCTC 2 cut(s) 639, 1247
BsrDI GCAATG 1 cut(s) 1813
BsrFI RCCGGY 2 cut(s) 436, 544
BsrGI TGTACA 1 cut(s) 228
BsrI ACTGG 4 cut(s) 731, 854, 1136, 1606
BssAI RCCGGY 2 cut(s) 436, 544
BssECI CCNNGG 7 cut(s) 83, 619, 923, 1643, 1696, 2250, 2850
BssT1I CCWWGG 4 cut(s) 83, 619, 1643, 2250
Bst2UI CCWGG 2 cut(s) 1697, 2852
Bst4CI ACNGT 7 cut(s) 706, 814, 844, 900, 1165, 1758, 2951
Bst6I CTCTTC 8 cut(s) 26, 407, 515, 718, 919, 2130, 2202, 2502
BstAFI CTTAAG 2 cut(s) 1421, 2777
BstAPI GCANNNNNTGC 4 cut(s) 362, 833, 1028, 1592
BstAUI TGTACA 1 cut(s) 228
BstBAI YACGTR 1 cut(s) 701
BstC8I GCNNGC 6 cut(s) 1024, 1519, 1549, 2120, 2293, 2487
BstDSI CCRYGG 2 cut(s) 83, 619
BstENI CCTNNNNNAGG 2 cut(s) 2074, 2933
BstF5I GGATG 6 cut(s) 646, 1432, 2173, 2362, 2389, 2420
BstFNI CGCG 1 cut(s) 259
BstHHI GCGC 2 cut(s) 259, 2297
BstMAI GTCTC 4 cut(s) 99, 174, 639, 1247
BstMWI GCNNNNNNNGC 7 cut(s) 362, 725, 833, 1028, 1574, 1583, 1592
BstNI CCWGG 2 cut(s) 1697, 2852
BstNSI RCATGY 2 cut(s) 68, 1223
BstSCI CCNGG 3 cut(s) 1695, 1904, 2850
BstSFI CTRYAG 1 cut(s) 1956
BstUI CGCG 1 cut(s) 259
BstV2I GAAGAC 2 cut(s) 678, 2432
BstX2I RGATCY 4 cut(s) 1503, 1559, 1852, 2221
BstXI CCANNNNNNTGG 1 cut(s) 2111
BstYI RGATCY 4 cut(s) 1503, 1559, 1852, 2221
Bsu36I CCTNAGG 1 cut(s) 2756
BsuRI GGCC 4 cut(s) 88, 596, 1461, 2103
BtgI CCRYGG 2 cut(s) 83, 619
BtsCI GGATG 6 cut(s) 646, 1432, 2173, 2362, 2389, 2420
BtsIMutI CAGTG 8 cut(s) 398, 506, 840, 896, 984, 2398, 2778, 2956
BveI ACCTGC 2 cut(s) 841, 940
Cac8I GCNNGC 6 cut(s) 1024, 1519, 1549, 2120, 2293, 2487
CaiI CAGNNNCTG 4 cut(s) 833, 2651, 2708, 2955
CciI TCATGA 2 cut(s) 2017, 2463
CfoI GCGC 2 cut(s) 259, 2297
Cfr10I RCCGGY 2 cut(s) 436, 544
Cfr13I GGNCC 4 cut(s) 87, 1727, 2325, 2548
CseI GACGC 2 cut(s) 141, 753
Csp6I GTAC 5 cut(s) 229, 702, 815, 1206, 1800
CspCI CAANNNNNGTGG 2 cut(s) 387, 422
CviQI GTAC 5 cut(s) 229, 702, 815, 1206, 1800
DraI TTTAAA 2 cut(s) 1146, 2428
DraIII CACNNNGTG 1 cut(s) 749
DriI GACNNNNNGTC 1 cut(s) 1260
EaeI YGGCCR 2 cut(s) 594, 2101
Eam1104I CTCTTC 8 cut(s) 26, 407, 515, 718, 919, 2130, 2202, 2502
Eam1105I GACNNNNNGTC 1 cut(s) 1260
EarI CTCTTC 8 cut(s) 26, 407, 515, 718, 919, 2130, 2202, 2502
Eco130I CCWWGG 4 cut(s) 83, 619, 1643, 2250
Eco24I GRGCYC 1 cut(s) 2747
Eco31I GGTCTC 2 cut(s) 639, 1247
Eco32I GATATC 1 cut(s) 2921
Eco47I GGWCC 3 cut(s) 1727, 2325, 2548
Eco57I CTGAAG 3 cut(s) 1335, 2226, 2909
Eco81I CCTNAGG 1 cut(s) 2756
EcoNI CCTNNNNNAGG 2 cut(s) 2074, 2933
EcoO109I RGGNCCY 1 cut(s) 2548
EcoRII CCWGG 2 cut(s) 1695, 2850
EcoRV GATATC 1 cut(s) 2921
EcoT14I CCWWGG 4 cut(s) 83, 619, 1643, 2250
EcoT22I ATGCAT 1 cut(s) 868
EcoT38I GRGCYC 1 cut(s) 2747
ErhI CCWWGG 4 cut(s) 83, 619, 1643, 2250
Esp3I CGTCTC 2 cut(s) 99, 174
FalI AAGNNNNNCTT 4 cut(s) 266, 298, 1636, 1668
FauNDI CATATG 1 cut(s) 1947
FbaI TGATCA 6 cut(s) 145, 679, 1057, 2014, 2395, 2538
FblI GTMKAC 1 cut(s) 1406
FokI GGATG 6 cut(s) 653, 1439, 2180, 2369, 2396, 2407
FriOI GRGCYC 1 cut(s) 2747
FspBI CTAG 6 cut(s) 789, 1107, 1374, 1530, 2129, 2793
GlaI GCGC 2 cut(s) 258, 2296
GsaI CCCAGC 1 cut(s) 2750
GsuI CTGGAG 2 cut(s) 1421, 2685
HaeIII GGCC 4 cut(s) 88, 596, 1461, 2103
HapII CCGG 5 cut(s) 28, 218, 437, 545, 1906
HgaI GACGC 2 cut(s) 141, 753
HhaI GCGC 2 cut(s) 259, 2297
Hin6I GCGC 2 cut(s) 257, 2295
HinP1I GCGC 2 cut(s) 257, 2295
HincII GTYRAC 2 cut(s) 1650, 2871
HindII GTYRAC 2 cut(s) 1650, 2871
HindIII AAGCTT 3 cut(s) 1623, 1890, 2430
HpaII CCGG 5 cut(s) 28, 218, 437, 545, 1906
HphI GGTGA 9 cut(s) 155, 686, 735, 950, 1084, 2167, 2685, 2744, 2814
Hpy166II GTNNAC 4 cut(s) 1407, 1650, 2049, 2871
Hpy188I TCNGA 7 cut(s) 769, 927, 1384, 2233, 2479, 2907, 2918
Hpy8I GTNNAC 4 cut(s) 1407, 1650, 2049, 2871
HpyAV CCTTC 8 cut(s) 786, 972, 1055, 1248, 1567, 2047, 2890, 2938
HpyCH4III ACNGT 7 cut(s) 706, 814, 844, 900, 1165, 1758, 2951
HpyCH4IV ACGT 1 cut(s) 700
HpyF10VI GCNNNNNNNGC 7 cut(s) 362, 725, 833, 1028, 1574, 1583, 1592
HpySE526I ACGT 1 cut(s) 700
HspAI GCGC 2 cut(s) 257, 2295
Ksp22I TGATCA 6 cut(s) 145, 679, 1057, 2014, 2395, 2538
LguI GCTCTTC 1 cut(s) 919
LmnI GCTCC 3 cut(s) 1516, 2146, 2742
LweI GCATC 5 cut(s) 1111, 2056, 2202, 2457, 2540
MaeI CTAG 6 cut(s) 789, 1107, 1374, 1530, 2129, 2793
MaeII ACGT 1 cut(s) 700
MaeIII GTNAC 7 cut(s) 260, 706, 1138, 1490, 2563, 2653, 2951
MfeI CAATTG 3 cut(s) 777, 1410, 1671
MflI RGATCY 4 cut(s) 1503, 1559, 1852, 2221
MhlI GDGCHC 1 cut(s) 2747
MlsI TGGCCA 2 cut(s) 596, 2103
MluNI TGGCCA 2 cut(s) 596, 2103
MlyI GAGTC 4 cut(s) 125, 212, 1412, 1925
MmeI TCCRAC 6 cut(s) 157, 1159, 2145, 2256, 2796, 2885
Mox20I TGGCCA 2 cut(s) 596, 2103
Mph1103I ATGCAT 1 cut(s) 868
MroXI GAANNNNTTC 2 cut(s) 1044, 2057
MscI TGGCCA 2 cut(s) 596, 2103
MslI CAYNNNNRTG 4 cut(s) 494, 845, 879, 2109
Msp20I TGGCCA 2 cut(s) 596, 2103
MspA1I CMGCKG 5 cut(s) 1250, 1766, 1961, 2270, 2705
MspCI CTTAAG 2 cut(s) 1421, 2777
MspI CCGG 5 cut(s) 28, 218, 437, 545, 1906
MspR9I CCNGG 3 cut(s) 1697, 1906, 2852
MunI CAATTG 3 cut(s) 777, 1410, 1671
Mva1269I GAATGC 1 cut(s) 766
MvaI CCWGG 2 cut(s) 1697, 2852
MvnI CGCG 1 cut(s) 259
MwoI GCNNNNNNNGC 7 cut(s) 362, 725, 833, 1028, 1574, 1583, 1592
NciI CCSGG 1 cut(s) 1906
NcoI CCATGG 2 cut(s) 83, 619
NdeI CATATG 1 cut(s) 1947
NlaIV GGNNCC 5 cut(s) 729, 807, 1854, 2549, 2744
NmeAIII GCCGAG 2 cut(s) 233, 1504
NmuCI GTSAC 3 cut(s) 260, 1138, 2951
NsiI ATGCAT 1 cut(s) 868
NspI RCATGY 2 cut(s) 68, 1223
PagI TCATGA 2 cut(s) 2017, 2463
PaqCI CACCTGC 1 cut(s) 841
PciI ACATGT 1 cut(s) 64
PciSI GCTCTTC 1 cut(s) 919
PctI GAATGC 1 cut(s) 766
PdmI GAANNNNTTC 2 cut(s) 1044, 2057
PfoI TCCNGGA 1 cut(s) 1904
PleI GAGTC 4 cut(s) 124, 211, 1411, 1924
PpsI GAGTC 4 cut(s) 124, 211, 1411, 1924
Ppu21I YACGTR 1 cut(s) 701
PpuMI RGGWCCY 1 cut(s) 2548
PscI ACATGT 1 cut(s) 64
PshBI ATTAAT 2 cut(s) 450, 1607
Psp5II RGGWCCY 1 cut(s) 2548
Psp6I CCWGG 2 cut(s) 1695, 2850
PspFI CCCAGC 1 cut(s) 2746
PspGI CCWGG 2 cut(s) 1695, 2850
PspN4I GGNNCC 5 cut(s) 729, 807, 1854, 2549, 2744
PspPI GGNCC 4 cut(s) 87, 1727, 2325, 2548
PspPPI RGGWCCY 1 cut(s) 2548
PsrI GAACNNNNNNTAC 4 cut(s) 798, 830, 1582, 1614
PstI CTGCAG 1 cut(s) 1960
PstNI CAGNNNCTG 4 cut(s) 833, 2651, 2708, 2955
PsuI RGATCY 4 cut(s) 1503, 1559, 1852, 2221
PvuII CAGCTG 4 cut(s) 1250, 1961, 2270, 2705
RsaI GTAC 5 cut(s) 230, 703, 816, 1207, 1801
RsaNI GTAC 5 cut(s) 229, 702, 815, 1206, 1800
RseI CAYNNNNRTG 4 cut(s) 494, 845, 879, 2109
SapI GCTCTTC 1 cut(s) 919
Sau96I GGNCC 4 cut(s) 87, 1727, 2325, 2548
ScaI AGTACT 1 cut(s) 1207
SchI GAGTC 4 cut(s) 125, 212, 1412, 1925
ScrFI CCNGG 3 cut(s) 1697, 1906, 2852
SduI GDGCHC 1 cut(s) 2747
SfaNI GCATC 5 cut(s) 1111, 2056, 2202, 2457, 2540
SfcI CTRYAG 1 cut(s) 1956
SinI GGWCC 3 cut(s) 1727, 2325, 2548
SmiMI CAYNNNNRTG 4 cut(s) 494, 845, 879, 2109
SmlI CTYRAG 5 cut(s) 1421, 1563, 1713, 1972, 2777
SmoI CTYRAG 5 cut(s) 1421, 1563, 1713, 1972, 2777
SpeI ACTAGT 1 cut(s) 2792
SsiI CCGC 3 cut(s) 41, 1442, 1766
SspI AATATT 1 cut(s) 1082
SspMI CTAG 6 cut(s) 789, 1107, 1374, 1530, 2129, 2793
StyD4I CCNGG 3 cut(s) 1695, 1904, 2850
StyI CCWWGG 4 cut(s) 83, 619, 1643, 2250
TaaI ACNGT 7 cut(s) 706, 814, 844, 900, 1165, 1758, 2951
TaiI ACGT 1 cut(s) 703
TaqI TCGA 3 cut(s) 307, 1664, 2092
TatI WGTACW 2 cut(s) 228, 1205
TauI GCSGC 1 cut(s) 1445
TscAI CASTG 8 cut(s) 405, 513, 847, 903, 984, 2398, 2778, 2956
TseFI GTSAC 3 cut(s) 260, 1138, 2951
Tsp45I GTSAC 3 cut(s) 260, 1138, 2951
TspGWI ACGGA 2 cut(s) 2426, 2921
TspRI CASTG 8 cut(s) 405, 513, 847, 903, 984, 2398, 2778, 2956
Vha464I CTTAAG 2 cut(s) 1421, 2777
VpaK11BI GGWCC 3 cut(s) 1727, 2325, 2548
VspI ATTAAT 2 cut(s) 450, 1607
XagI CCTNNNNNAGG 2 cut(s) 2074, 2933
XapI RAATTY 2 cut(s) 194, 2845
XbaI TCTAGA 1 cut(s) 1529
XceI RCATGY 2 cut(s) 68, 1223
XcmI CCANNNNNNNNNTGG 2 cut(s) 626, 2889
XmiI GTMKAC 1 cut(s) 1406
XmnI GAANNNNTTC 2 cut(s) 1044, 2057
XspI CTAG 6 cut(s) 789, 1107, 1374, 1530, 2129, 2793
ZrmI AGTACT 1 cut(s) 1207
Zsp2I ATGCAT 1 cut(s) 868
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.