Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0030097.1

Orthogroup ID

OG0003470

Physical Location & Seq

Genomic Coordinates Forward (+)

5 .. 3274

Gene Structure 3270 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0030097.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2019 bp

atgggcaaaattgtgagcaaccatgcttctgaaggtacaacctcaagtacatctctgcagcaggctacaaactcaatatctgcaagctatgcagatttagaatcccttcaagatgatgatcatctcgttaaggtgaatgaatattcttttgatggcaaattagcttctaggttttcacaagatgctaccagaaagccagtcactttaaagagtgaaacttttacagtcagcaataatgttggatcacgggaaagcaaggttaaaagtactgaattaaagcatgtaaagtccatgaaaccttctatctcagctgagaccaatagtcggttaagaaaacatgagtttatgaaaaagtcaaaggaagctgagattcctgaagatggtcgtgttggtggtatcattagtgcaaagtgtgaaagagaagaaacagcaactagctgttctgatagtaaaattgagctggagtctacaattgaaatgcttaaggatgagttgagagaagcggctgctgttgaggttggcctttactccattgtcgccgagcatgggagtaacacgaataagatccatgctcctgctcgccgactttctagattctattttcatgcttgcaaaatgagatctcaagctaagaaggcaaatgcagcaagaactgctattactggattaattttggtttctaaagcttgtggaaatgatgttccaaggttgactttctggttgtcgaactcaattgtgttgagagctattgtcagccagggcttagggaaagctcaagtttcaaatggaccatgcactacaattaaaggtggcaaacagtatgcagcggataggtatttatcagcaaaggataggattcgtactcgcaatgatgagaaagataacattcttgaaagttttgataattgggaggatccacatatatttatggttgctttggaaaagtttgaagcttggatattctcccggatagttgagtctgtatggtggcagaatataactccacatatgcagtctgcagctgcgaaaggctcaagcacaaggaaagctaatggaagaaagaaaggtttgagtgatcatgagcagggtaatttttctattgagctgtggacgaaggctttcaaagatgcctgtgaaaggctctgtcctgttcgagctggtggccataagtgtggctgcttgcctcttctagctcgtttggtcatggagcagttggtgagtaggttggatgtggctatgttcaatgctattcttcgtgaaaatgctgaagagatgcccacagatcccgtgtccgaccctataagtgattccaaggttctccctattccagctggaaaatcaagttttggggcaggtgcacagctaaaaaatgcgattggaagctggtccagatggctgactgatctatttggtatggatgatactgatgttccagacgatgaggatgaactcagtgatcacaaggggcaggagagtgaaacatcctttaaagctttccgtcttctcaatgctttgagtgatctcatgatgcttccatctgaaatgcttgcagataaatccaccagagaagaggtatgccctacattcggtgcatcaatgatcaagagggtcctttacaattttgttacagatgagttttgcccagacccgattcccgaagcagtttttgaggctcttgacaatgaggagaatctggaagctgaaacagaatctgttacaagtttcccatttattgcaaatcccacattttattcaccacctccagctgctgcttctctatcaggcattacaggagaggtggggagcccagctcacctaaggagtgggtcatcagtgcttaagaaatcatatactagtgatgatgagcttgatgagttggattcaccgatgacatcaatcgtagaaaattcccaggtttcccccaagtcgttgacagccaacccaatgctgaagtggaagggtggtcggaaagttgtccgatatcaactcctccgtcaggtttggaaggacagtgactga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NT-C2

Protein Analysis

672

Amino Acids

74.15

Weight (kDa)

5.86

Isoelectric Point (pI)

43.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003470)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g24100 FvH4_4g24100 FvH4_4g24100
malus_domestica	MD13G1115500.v1.1 MD16G1115400.v1.1
prunus_persica	Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1 Prupe.1G231700_v2.0.a1
pyrus_communis	pycom13g10000 pycom16g09790
rosa_chinensis	RchiOBHm_Chr4g0430881
rosa_laevigata	RLG00000006942
rosa_multiflora	Rmu_sc0006263.1_g000008 Rmu_sc0030097.1_g000001 Rmu_sc0030098.1_g000001
rosa_roxburghii	Rroxscaffold_5G00372570
rosa_rugosa	Rorug04G0246700 Rorug04G0246800 Rorug04G0246900 Rorug04G0247000
rosa_samantha	Rh4AG302500 Rh4AG303400 Rh4BG310600 Rh4CG327000 Rh4DG306800
rosa_wichuraiana	Rw4G026290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	1343
Acc36I	ACCTGC	1 cut(s)	1343
AccI	GTMKAC	1 cut(s)	467
AciI	CCGC	2 cut(s)	503, 827
AclWI	GGATC	5 cut(s)	250, 559, 908, 921, 1277
AcoI	YGGCCR	1 cut(s)	1162
AcsI	RAATTY	1 cut(s)	1906
AcuI	CTGAAG	4 cut(s)	51, 396, 1287, 1970
AfaI	GTAC	4 cut(s)	37, 49, 268, 862
AfiI	CCNNNNNNNGG	6 cut(s)	324, 380, 546, 1137, 1586, 1996
AflII	CTTAAG	2 cut(s)	482, 1838
AgsI	TTSAA	7 cut(s)	110, 476, 783, 893, 950, 1123, 1243
AhdI	GACNNNNNGTC	1 cut(s)	321
AhlI	ACTAGT	1 cut(s)	1853
AjnI	CCWGG	2 cut(s)	756, 1911
AloI	GAACNNNNNNTCC	2 cut(s)	684, 716
Alw21I	GWGCWC	1 cut(s)	1360
Alw26I	GTCTC	1 cut(s)	308
Alw44I	GTGCAC	1 cut(s)	1356
AlwI	GGATC	5 cut(s)	250, 559, 908, 921, 1277
AlwNI	CAGNNNCTG	3 cut(s)	1712, 1769, 2016
AoxI	GGCC	2 cut(s)	520, 1162
ApaLI	GTGCAC	1 cut(s)	1356
ApeKI	GCWGC	9 cut(s)	58, 506, 644, 824, 1019, 1022, 1176, 1766, 1769
ApoI	RAATTY	1 cut(s)	1906
AseI	ATTAAT	1 cut(s)	668
Asp700I	GAANNNNTTC	2 cut(s)	105, 1118
AspS9I	GGNCC	3 cut(s)	788, 1386, 1609
AsuC2I	CCSGG	1 cut(s)	967
AsuHPI	GGTGA	5 cut(s)	145, 1228, 1746, 1805, 1875
AvaII	GGWCC	3 cut(s)	788, 1386, 1609
AxyI	CCTNAGG	1 cut(s)	1817
BaeGI	GKGCMC	1 cut(s)	1360
BaeI	ACNNNNGTAYC	2 cut(s)	1413, 1446
BalI	TGGCCA	1 cut(s)	1164
BamHI	GGATCC	1 cut(s)	913
BanII	GRGCYC	1 cut(s)	1808
BbsI	GAAGAC	1 cut(s)	1493
Bbv12I	GWGCWC	1 cut(s)	1360
BbvI	GCAGC	9 cut(s)	70, 493, 656, 836, 1009, 1031, 1163, 1753, 1756
BccI	CCATC	4 cut(s)	146, 374, 1386, 1543
BciT130I	CCWGG	2 cut(s)	758, 1913
BclI	TGATCA	4 cut(s)	118, 1075, 1456, 1599
BcnI	CCSGG	1 cut(s)	967
BcoDI	GTCTC	1 cut(s)	308
BcuI	ACTAGT	1 cut(s)	1853
BfaI	CTAG	5 cut(s)	168, 435, 591, 1190, 1854
BfmI	CTRYAG	2 cut(s)	56, 1017
BfrI	CTTAAG	2 cut(s)	482, 1838
BfuAI	ACCTGC	1 cut(s)	1343
BglII	AGATCT	1 cut(s)	620
BmcAI	AGTACT	1 cut(s)	268
Bme1390I	CCNGG	3 cut(s)	758, 967, 1913
Bme18I	GGWCC	3 cut(s)	788, 1386, 1609
BmeRI	GACNNNNNGTC	1 cut(s)	321
BmgT120I	GGNCC	3 cut(s)	788, 1386, 1609
BmiI	GGNNCC	3 cut(s)	915, 1610, 1805
BmrFI	CCNGG	3 cut(s)	758, 967, 1913
BmsI	GCATC	5 cut(s)	172, 1117, 1263, 1518, 1601
BpiI	GAAGAC	1 cut(s)	1493
BplI	GAGNNNNNCTC	2 cut(s)	1795, 1827
BpmI	CTGGAG	2 cut(s)	482, 1746
Bpu10I	CCTNAGC	1 cut(s)	763
BpuEI	CTTGAG	4 cut(s)	28, 609, 759, 1018
BpuMI	CCSGG	1 cut(s)	967
BsaBI	GATNNNNATC	2 cut(s)	117, 120
BsaI	GGTCTC	1 cut(s)	308
BsaJI	CCNNGG	4 cut(s)	704, 757, 1311, 1911
Bsc4I	CCNNNNNNNGG	6 cut(s)	324, 380, 546, 1137, 1586, 1996
Bse1I	ACTGG	2 cut(s)	197, 667
Bse21I	CCTNAGG	1 cut(s)	1817
Bse3DI	GCAATG	1 cut(s)	874
Bse8I	GATNNNNATC	2 cut(s)	117, 120
BseBI	CCWGG	2 cut(s)	758, 1913
BseDI	CCNNGG	4 cut(s)	704, 757, 1311, 1911
BseGI	GGATG	5 cut(s)	493, 1234, 1423, 1450, 1481
BseJI	GATNNNNATC	2 cut(s)	117, 120
BseLI	CCNNNNNNNGG	6 cut(s)	324, 380, 546, 1137, 1586, 1996
BseMI	GCAATG	1 cut(s)	874
BseMII	CTCAG	4 cut(s)	303, 321, 357, 1465
BseNI	ACTGG	2 cut(s)	197, 667
BseRI	GAGGAG	2 cut(s)	1700, 1979
BseSI	GKGCMC	1 cut(s)	1360
BseXI	GCAGC	9 cut(s)	70, 493, 656, 836, 1009, 1031, 1163, 1753, 1756
BseYI	CCCAGC	1 cut(s)	1807
BshFI	GGCC	2 cut(s)	522, 1164
BsiHKAI	GWGCWC	1 cut(s)	1360
BsiSI	CCGG	1 cut(s)	967
BslI	CCNNNNNNNGG	6 cut(s)	324, 380, 546, 1137, 1586, 1996
BsmAI	GTCTC	1 cut(s)	308
BsnI	GGCC	2 cut(s)	522, 1164
Bso31I	GGTCTC	1 cut(s)	308
Bsp1286I	GDGCHC	2 cut(s)	1360, 1808
BspACI	CCGC	2 cut(s)	503, 827
BspANI	GGCC	2 cut(s)	522, 1164
BspCNI	CTCAG	4 cut(s)	304, 320, 358, 1464
BspHI	TCATGA	2 cut(s)	1078, 1524
BspLI	GGNNCC	3 cut(s)	915, 1610, 1805
BspMAI	CTGCAG	2 cut(s)	60, 1021
BspMI	ACCTGC	1 cut(s)	1343
BspPI	GGATC	5 cut(s)	250, 559, 908, 921, 1277
BspTI	CTTAAG	2 cut(s)	482, 1838
BspTNI	GGTCTC	1 cut(s)	308
BsrDI	GCAATG	1 cut(s)	874
BsrI	ACTGG	2 cut(s)	197, 667
BssECI	CCNNGG	4 cut(s)	704, 757, 1311, 1911
BssT1I	CCWWGG	2 cut(s)	704, 1311
Bst2UI	CCWGG	2 cut(s)	758, 1913
Bst4CI	ACNGT	3 cut(s)	226, 819, 2012
Bst6I	CTCTTC	3 cut(s)	1191, 1263, 1563
BstAFI	CTTAAG	2 cut(s)	482, 1838
BstAPI	GCANNNNNTGC	2 cut(s)	89, 653
BstC8I	GCNNGC	6 cut(s)	63, 85, 580, 610, 1181, 1548
BstDEI	CTNAG	7 cut(s)	307, 312, 366, 630, 763, 1451, 1817
BstENI	CCTNNNNNAGG	2 cut(s)	1135, 1994
BstF5I	GGATG	5 cut(s)	493, 1234, 1423, 1450, 1481
BstMAI	GTCTC	1 cut(s)	308
BstMWI	GCNNNNNNNGC	4 cut(s)	89, 635, 644, 653
BstNI	CCWGG	2 cut(s)	758, 1913
BstNSI	RCATGY	1 cut(s)	284
BstSCI	CCNGG	3 cut(s)	756, 965, 1911
BstSFI	CTRYAG	2 cut(s)	56, 1017
BstSLI	GKGCMC	1 cut(s)	1360
BstV1I	GCAGC	9 cut(s)	70, 493, 656, 836, 1009, 1031, 1163, 1753, 1756
BstV2I	GAAGAC	1 cut(s)	1493
BstX2I	RGATCY	4 cut(s)	564, 620, 913, 1282
BstXI	CCANNNNNNTGG	1 cut(s)	1172
BstYI	RGATCY	4 cut(s)	564, 620, 913, 1282
Bsu36I	CCTNAGG	1 cut(s)	1817
BsuRI	GGCC	2 cut(s)	522, 1164
BtsCI	GGATG	5 cut(s)	493, 1234, 1423, 1450, 1481
BtsIMutI	CAGTG	3 cut(s)	1459, 1839, 2017
BveI	ACCTGC	1 cut(s)	1343
Cac8I	GCNNGC	6 cut(s)	63, 85, 580, 610, 1181, 1548
CaiI	CAGNNNCTG	3 cut(s)	1712, 1769, 2016
CciI	TCATGA	2 cut(s)	1078, 1524
Cfr13I	GGNCC	3 cut(s)	788, 1386, 1609
Csp6I	GTAC	4 cut(s)	36, 48, 267, 861
CviQI	GTAC	4 cut(s)	36, 48, 267, 861
DdeI	CTNAG	7 cut(s)	307, 312, 366, 630, 763, 1451, 1817
DraI	TTTAAA	2 cut(s)	207, 1489
DriI	GACNNNNNGTC	1 cut(s)	321
EaeI	YGGCCR	1 cut(s)	1162
Eam1104I	CTCTTC	3 cut(s)	1191, 1263, 1563
Eam1105I	GACNNNNNGTC	1 cut(s)	321
EarI	CTCTTC	3 cut(s)	1191, 1263, 1563
Eco130I	CCWWGG	2 cut(s)	704, 1311
Eco24I	GRGCYC	1 cut(s)	1808
Eco31I	GGTCTC	1 cut(s)	308
Eco32I	GATATC	1 cut(s)	1982
Eco47I	GGWCC	3 cut(s)	788, 1386, 1609
Eco57I	CTGAAG	4 cut(s)	51, 396, 1287, 1970
Eco81I	CCTNAGG	1 cut(s)	1817
EcoNI	CCTNNNNNAGG	2 cut(s)	1135, 1994
EcoO109I	RGGNCCY	1 cut(s)	1609
EcoRII	CCWGG	2 cut(s)	756, 1911
EcoRV	GATATC	1 cut(s)	1982
EcoT14I	CCWWGG	2 cut(s)	704, 1311
EcoT38I	GRGCYC	1 cut(s)	1808
ErhI	CCWWGG	2 cut(s)	704, 1311
FalI	AAGNNNNNCTT	2 cut(s)	697, 729
FauNDI	CATATG	1 cut(s)	1008
FbaI	TGATCA	4 cut(s)	118, 1075, 1456, 1599
FblI	GTMKAC	1 cut(s)	467
FokI	GGATG	5 cut(s)	500, 1241, 1430, 1457, 1468
FriOI	GRGCYC	1 cut(s)	1808
FspBI	CTAG	5 cut(s)	168, 435, 591, 1190, 1854
GsaI	CCCAGC	1 cut(s)	1811
GsuI	CTGGAG	2 cut(s)	482, 1746
HaeIII	GGCC	2 cut(s)	522, 1164
HapII	CCGG	1 cut(s)	967
HincII	GTYRAC	2 cut(s)	711, 1932
HindII	GTYRAC	2 cut(s)	711, 1932
HindIII	AAGCTT	3 cut(s)	684, 951, 1491
HpaII	CCGG	1 cut(s)	967
HphI	GGTGA	5 cut(s)	145, 1228, 1746, 1805, 1875
Hpy166II	GTNNAC	5 cut(s)	468, 711, 1110, 1358, 1932
Hpy188I	TCNGA	6 cut(s)	31, 445, 1294, 1540, 1968, 1979
Hpy8I	GTNNAC	5 cut(s)	468, 711, 1110, 1358, 1932
HpyAV	CCTTC	7 cut(s)	26, 116, 309, 628, 1108, 1951, 1999
HpyCH4III	ACNGT	3 cut(s)	226, 819, 2012
HpyF10VI	GCNNNNNNNGC	4 cut(s)	89, 635, 644, 653
HpyF3I	CTNAG	7 cut(s)	307, 312, 366, 630, 763, 1451, 1817
Ksp22I	TGATCA	4 cut(s)	118, 1075, 1456, 1599
LmnI	GCTCC	3 cut(s)	577, 1207, 1803
Lsp1109I	GCAGC	9 cut(s)	70, 493, 656, 836, 1009, 1031, 1163, 1753, 1756
LweI	GCATC	5 cut(s)	172, 1117, 1263, 1518, 1601
MaeI	CTAG	5 cut(s)	168, 435, 591, 1190, 1854
MaeIII	GTNAC	5 cut(s)	199, 551, 1624, 1714, 2012
MboII	GAAGA	8 cut(s)	389, 434, 1068, 1178, 1244, 1280, 1493, 1580
MfeI	CAATTG	2 cut(s)	471, 732
MflI	RGATCY	4 cut(s)	564, 620, 913, 1282
MhlI	GDGCHC	2 cut(s)	1360, 1808
MlsI	TGGCCA	1 cut(s)	1164
MluNI	TGGCCA	1 cut(s)	1164
MlyI	GAGTC	2 cut(s)	473, 986
MmeI	TCCRAC	5 cut(s)	220, 1206, 1317, 1857, 1946
Mox20I	TGGCCA	1 cut(s)	1164
MroXI	GAANNNNTTC	2 cut(s)	105, 1118
MscI	TGGCCA	1 cut(s)	1164
MslI	CAYNNNNRTG	1 cut(s)	1170
Msp20I	TGGCCA	1 cut(s)	1164
MspA1I	CMGCKG	5 cut(s)	311, 827, 1022, 1331, 1766
MspCI	CTTAAG	2 cut(s)	482, 1838
MspI	CCGG	1 cut(s)	967
MspR9I	CCNGG	3 cut(s)	758, 967, 1913
MunI	CAATTG	2 cut(s)	471, 732
MvaI	CCWGG	2 cut(s)	758, 1913
MwoI	GCNNNNNNNGC	4 cut(s)	89, 635, 644, 653
NciI	CCSGG	1 cut(s)	967
NdeI	CATATG	1 cut(s)	1008
NlaIV	GGNNCC	3 cut(s)	915, 1610, 1805
NmeAIII	GCCGAG	1 cut(s)	565
NmuCI	GTSAC	2 cut(s)	199, 2012
NspI	RCATGY	1 cut(s)	284
PagI	TCATGA	2 cut(s)	1078, 1524
PaqCI	CACCTGC	1 cut(s)	1343
PdmI	GAANNNNTTC	2 cut(s)	105, 1118
PfeI	GAWTC	9 cut(s)	101, 370, 594, 856, 1307, 1651, 1690, 1709, 1880
PfoI	TCCNGGA	1 cut(s)	965
PleI	GAGTC	2 cut(s)	472, 985
PpsI	GAGTC	2 cut(s)	472, 985
PpuMI	RGGWCCY	1 cut(s)	1609
PshBI	ATTAAT	1 cut(s)	668
Psp5II	RGGWCCY	1 cut(s)	1609
Psp6I	CCWGG	2 cut(s)	756, 1911
PspFI	CCCAGC	1 cut(s)	1807
PspGI	CCWGG	2 cut(s)	756, 1911
PspN4I	GGNNCC	3 cut(s)	915, 1610, 1805
PspPI	GGNCC	3 cut(s)	788, 1386, 1609
PspPPI	RGGWCCY	1 cut(s)	1609
PsrI	GAACNNNNNNTAC	2 cut(s)	643, 675
PstI	CTGCAG	2 cut(s)	60, 1021
PstNI	CAGNNNCTG	3 cut(s)	1712, 1769, 2016
PsuI	RGATCY	4 cut(s)	564, 620, 913, 1282
PvuII	CAGCTG	4 cut(s)	311, 1022, 1331, 1766
RsaI	GTAC	4 cut(s)	37, 49, 268, 862
RsaNI	GTAC	4 cut(s)	36, 48, 267, 861
RseI	CAYNNNNRTG	1 cut(s)	1170
Sau96I	GGNCC	3 cut(s)	788, 1386, 1609
ScaI	AGTACT	1 cut(s)	268
SchI	GAGTC	2 cut(s)	473, 986
ScrFI	CCNGG	3 cut(s)	758, 967, 1913
SduI	GDGCHC	2 cut(s)	1360, 1808
SfaNI	GCATC	5 cut(s)	172, 1117, 1263, 1518, 1601
SfcI	CTRYAG	2 cut(s)	56, 1017
SinI	GGWCC	3 cut(s)	788, 1386, 1609
SmiMI	CAYNNNNRTG	1 cut(s)	1170
SmlI	CTYRAG	6 cut(s)	43, 482, 624, 774, 1033, 1838
SmoI	CTYRAG	6 cut(s)	43, 482, 624, 774, 1033, 1838
SpeI	ACTAGT	1 cut(s)	1853
SsiI	CCGC	2 cut(s)	503, 827
SspI	AATATT	1 cut(s)	143
SspMI	CTAG	5 cut(s)	168, 435, 591, 1190, 1854
StyD4I	CCNGG	3 cut(s)	756, 965, 1911
StyI	CCWWGG	2 cut(s)	704, 1311
TaaI	ACNGT	3 cut(s)	226, 819, 2012
TaqI	TCGA	2 cut(s)	725, 1153
TatI	WGTACW	2 cut(s)	47, 266
TauI	GCSGC	1 cut(s)	506
TfiI	GAWTC	9 cut(s)	101, 370, 594, 856, 1307, 1651, 1690, 1709, 1880
TscAI	CASTG	3 cut(s)	1459, 1839, 2017
TseFI	GTSAC	2 cut(s)	199, 2012
TseI	GCWGC	9 cut(s)	58, 506, 644, 824, 1019, 1022, 1176, 1766, 1769
Tsp45I	GTSAC	2 cut(s)	199, 2012
TspDTI	ATGAA	5 cut(s)	153, 308, 362, 593, 1461
TspGWI	ACGGA	2 cut(s)	1487, 1982
TspRI	CASTG	3 cut(s)	1459, 1839, 2017
Vha464I	CTTAAG	2 cut(s)	482, 1838
VneI	GTGCAC	1 cut(s)	1356
VpaK11BI	GGWCC	3 cut(s)	788, 1386, 1609
VspI	ATTAAT	1 cut(s)	668
XagI	CCTNNNNNAGG	2 cut(s)	1135, 1994
XapI	RAATTY	1 cut(s)	1906
XbaI	TCTAGA	1 cut(s)	590
XceI	RCATGY	1 cut(s)	284
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1950
XmiI	GTMKAC	1 cut(s)	467
XmnI	GAANNNNTTC	2 cut(s)	105, 1118
XspI	CTAG	5 cut(s)	168, 435, 591, 1190, 1854
ZrmI	AGTACT	1 cut(s)	268

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.