Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006273.1

Orthogroup ID

OG0006368

Physical Location & Seq

Genomic Coordinates Forward (+)

9746 .. 11569

Gene Structure 1824 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006273.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 825 bp

atgcaaatcgagctccagaatctggcatgggataggaaagagcttgaggaacatctacaaaaagcaattaaagaacaaaaaatgatggagctgatattagcagagcttgaagaagaacatgacaaggtcattgccaaaattgaagtgctagtgggcgagttacaggatctgaaaactgaaaatcttcgactgaaagaagttcaaggaaagagctattggaactttaaaggccgagatgaaacaagtgatgtccataatatagcaatcgctgactatggcattccctacgggatcccatcatggaaatccagttatgatggaagtggtattgtcctccaggaccttctaatgcgcaaagatgcgtggggagaagaaagtaaacttaaaaccgagttgcagatcttaagaaatgattcaaagtacgttgggcctgttcatcctattatgcctgaaaccaactccagaattgtagatattggtaaactttttccccaacgaagggttattgcaatgaaacagagtctatttagtgcagttttatcgcttttggttggaatgattatctggcaagctgaagacccttgcatgccccttgtcgtggctctcttcactgtagttggcatgtcattaaagagtgttgtcgagtttttctcaaccataaagaacagacctgcttcggatgctgttgctctcttaagcttcaactggttcatactaggcacacttacctacccaacactgccgagggttgcccatatggtggcaccagtggcatcaaatcttgtggaccgggtattaagctggcttggtttctctttttcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

274

Amino Acids

31.07

Weight (kDa)

5.64

Isoelectric Point (pI)

42.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006368)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G45310 AT5G45310
fragaria_vesca	FvH4_5g24810 FvH4_5g24810
malus_domestica	MD06G1011900.v1.1 MD16G1286500.v1.1
prunus_persica	Prupe.5G014600_v2.0.a1 Prupe.5G014600_v2.0.a1 Prupe.5G014600_v2.0.a1 Prupe.5G014600_v2.0.a1 Prupe.5G014600_v2.0.a1 Prupe.5G014600_v2.0.a1 Prupe.5G014600_v2.0.a1
pyrus_communis	pycom06g01000 pycom16g25740 pycom16g25750
rosa_chinensis	RchiOBHm_Chr7g0215151
rosa_laevigata	RLG00000002688
rosa_multiflora	Rmu_sc0006273.1_g000002
rosa_roxburghii	Rroxscaffold_3G00244560
rosa_rugosa	Rorug07G0150500 Rorug07G0150600
rosa_samantha	Rh7AG287400 Rh7BG279200 Rh7CG307100 Rh7DG290700
rosa_wichuraiana	Rw7G024510

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	353
Acc36I	ACCTGC	1 cut(s)	679
AccB1I	GGYRCC	1 cut(s)	763
AccB7I	CCANNNNNTGG	2 cut(s)	22, 760
AclWI	GGATC	3 cut(s)	174, 286, 299
AcuI	CTGAAG	1 cut(s)	594
AfaI	GTAC	1 cut(s)	422
AfiI	CCNNNNNNNGG	5 cut(s)	22, 498, 499, 598, 760
AflII	CTTAAG	2 cut(s)	403, 694
AgsI	TTSAA	5 cut(s)	110, 143, 203, 417, 703
AjnI	CCWGG	1 cut(s)	336
AjuI	GAANNNNNNNTTGG	2 cut(s)	199, 231
AluBI	AGCT	8 cut(s)	13, 43, 91, 106, 213, 572, 699, 801
AluI	AGCT	8 cut(s)	13, 43, 91, 106, 213, 572, 699, 801
Alw21I	GWGCWC	1 cut(s)	15
AlwI	GGATC	3 cut(s)	174, 286, 299
AlwNI	CAGNNNCTG	2 cut(s)	22, 169
AoxI	GGCC	2 cut(s)	229, 428
Asp700I	GAANNNNTTC	2 cut(s)	183, 412
AspLEI	GCGC	1 cut(s)	354
AspS9I	GGNCC	3 cut(s)	340, 428, 787
AsuC2I	CCSGG	1 cut(s)	791
AvaII	GGWCC	2 cut(s)	340, 787
BamHI	GGATCC	1 cut(s)	291
BanI	GGYRCC	1 cut(s)	763
BanII	GRGCYC	1 cut(s)	15
BbsI	GAAGAC	1 cut(s)	582
Bbv12I	GWGCWC	1 cut(s)	15
BccI	CCATC	3 cut(s)	79, 304, 311
BcgI	CGANNNNNNTGC	2 cut(s)	522, 556
BciT130I	CCWGG	1 cut(s)	338
BcnI	CCSGG	1 cut(s)	791
BfaI	CTAG	3 cut(s)	149, 716, 823
BfmI	CTRYAG	1 cut(s)	612
BfrI	CTTAAG	2 cut(s)	403, 694
BfuAI	ACCTGC	1 cut(s)	679
BglII	AGATCT	1 cut(s)	399
Bme1390I	CCNGG	2 cut(s)	338, 791
Bme18I	GGWCC	2 cut(s)	340, 787
BmgT120I	GGNCC	3 cut(s)	340, 428, 787
BmiI	GGNNCC	2 cut(s)	293, 765
BmrFI	CCNGG	2 cut(s)	338, 791
BmsI	GCATC	3 cut(s)	349, 670, 782
BpiI	GAAGAC	1 cut(s)	582
BplI	GAGNNNNNCTC	2 cut(s)	635, 667
BpmI	CTGGAG	2 cut(s)	320, 445
BpuEI	CTTGAG	1 cut(s)	65
BpuMI	CCSGG	1 cut(s)	791
BsaJI	CCNNGG	1 cut(s)	743
Bsc4I	CCNNNNNNNGG	5 cut(s)	22, 498, 499, 598, 760
Bse1I	ACTGG	3 cut(s)	309, 710, 767
Bse3DI	GCAATG	2 cut(s)	129, 516
BseBI	CCWGG	1 cut(s)	338
BseDI	CCNNGG	1 cut(s)	743
BseGI	GGATG	2 cut(s)	436, 685
BseLI	CCNNNNNNNGG	5 cut(s)	22, 498, 499, 598, 760
BseMI	GCAATG	2 cut(s)	129, 516
BseNI	ACTGG	3 cut(s)	309, 710, 767
BsgI	GTGCAG	1 cut(s)	552
BshFI	GGCC	2 cut(s)	231, 430
BshNI	GGYRCC	1 cut(s)	763
BsiHKAI	GWGCWC	1 cut(s)	15
BsiSI	CCGG	1 cut(s)	790
BslI	CCNNNNNNNGG	5 cut(s)	22, 498, 499, 598, 760
BsmI	GAATGC	1 cut(s)	279
BsnI	GGCC	2 cut(s)	231, 430
Bsp1286I	GDGCHC	1 cut(s)	15
Bsp143I	GATC	3 cut(s)	166, 291, 399
BspANI	GGCC	2 cut(s)	231, 430
BspLI	GGNNCC	2 cut(s)	293, 765
BspMI	ACCTGC	1 cut(s)	679
BspPI	GGATC	3 cut(s)	174, 286, 299
BspT107I	GGYRCC	1 cut(s)	763
BspTI	CTTAAG	2 cut(s)	403, 694
BsrDI	GCAATG	2 cut(s)	129, 516
BsrI	ACTGG	3 cut(s)	309, 710, 767
BssECI	CCNNGG	1 cut(s)	743
BssMI	GATC	3 cut(s)	166, 291, 399
Bst2UI	CCWGG	1 cut(s)	338
Bst4CI	ACNGT	1 cut(s)	613
Bst6I	CTCTTC	1 cut(s)	611
BstAFI	CTTAAG	2 cut(s)	403, 694
BstC8I	GCNNGC	3 cut(s)	570, 587, 803
BstF5I	GGATG	2 cut(s)	436, 685
BstHHI	GCGC	1 cut(s)	354
BstKTI	GATC	3 cut(s)	169, 294, 402
BstMBI	GATC	3 cut(s)	166, 291, 399
BstMWI	GCNNNNNNNGC	3 cut(s)	10, 680, 770
BstNI	CCWGG	1 cut(s)	338
BstNSI	RCATGY	2 cut(s)	589, 625
BstSCI	CCNGG	2 cut(s)	336, 789
BstSFI	CTRYAG	1 cut(s)	612
BstV2I	GAAGAC	1 cut(s)	582
BstX2I	RGATCY	3 cut(s)	166, 291, 399
BstYI	RGATCY	3 cut(s)	166, 291, 399
BsuRI	GGCC	2 cut(s)	231, 430
BtsCI	GGATG	2 cut(s)	436, 685
BtsI	GCAGTG	1 cut(s)	737
BtsIMutI	CAGTG	3 cut(s)	609, 737, 774
BveI	ACCTGC	1 cut(s)	679
Cac8I	GCNNGC	3 cut(s)	570, 587, 803
CaiI	CAGNNNCTG	2 cut(s)	22, 169
CfoI	GCGC	1 cut(s)	354
Cfr13I	GGNCC	3 cut(s)	340, 428, 787
Csp6I	GTAC	1 cut(s)	421
CspCI	CAANNNNNGTGG	2 cut(s)	765, 800
CviAII	CATG	5 cut(s)	27, 119, 300, 586, 622
CviQI	GTAC	1 cut(s)	421
DpnI	GATC	3 cut(s)	168, 293, 401
DpnII	GATC	3 cut(s)	166, 291, 399
DraI	TTTAAA	1 cut(s)	226
Eam1104I	CTCTTC	1 cut(s)	611
EarI	CTCTTC	1 cut(s)	611
Ecl136II	GAGCTC	1 cut(s)	13
Eco24I	GRGCYC	1 cut(s)	15
Eco47I	GGWCC	2 cut(s)	340, 787
Eco53kI	GAGCTC	1 cut(s)	13
Eco57I	CTGAAG	1 cut(s)	594
EcoICRI	GAGCTC	1 cut(s)	13
EcoO109I	RGGNCCY	1 cut(s)	340
EcoRII	CCWGG	1 cut(s)	336
EcoT38I	GRGCYC	1 cut(s)	15
FaeI	CATG	5 cut(s)	30, 122, 303, 589, 625
FatI	CATG	5 cut(s)	26, 118, 299, 585, 621
FauNDI	CATATG	1 cut(s)	756
FokI	GGATG	2 cut(s)	423, 692
FriOI	GRGCYC	1 cut(s)	15
FspBI	CTAG	3 cut(s)	149, 716, 823
FspI	TGCGCA	1 cut(s)	353
GlaI	GCGC	1 cut(s)	353
GsuI	CTGGAG	2 cut(s)	320, 445
HaeIII	GGCC	2 cut(s)	231, 430
HapII	CCGG	1 cut(s)	790
HhaI	GCGC	1 cut(s)	354
Hin1II	CATG	5 cut(s)	30, 122, 303, 589, 625
Hin6I	GCGC	1 cut(s)	352
HinP1I	GCGC	1 cut(s)	352
HindIII	AAGCTT	1 cut(s)	697
HinfI	GANTC	3 cut(s)	19, 413, 520
HpaII	CCGG	1 cut(s)	790
Hpy166II	GTNNAC	3 cut(s)	380, 482, 787
Hpy188I	TCNGA	2 cut(s)	171, 679
Hpy188III	TCNNGA	2 cut(s)	16, 462
Hpy8I	GTNNAC	3 cut(s)	380, 482, 787
HpyAV	CCTTC	2 cut(s)	353, 492
HpyCH4III	ACNGT	1 cut(s)	613
HpyCH4IV	ACGT	1 cut(s)	423
HpyCH4V	TGCA	5 cut(s)	4, 397, 509, 533, 585
HpyF10VI	GCNNNNNNNGC	3 cut(s)	10, 680, 770
HpySE526I	ACGT	1 cut(s)	423
Hsp92II	CATG	5 cut(s)	30, 122, 303, 589, 625
HspAI	GCGC	1 cut(s)	352
Kzo9I	GATC	3 cut(s)	166, 291, 399
LmnI	GCTCC	2 cut(s)	18, 88
LweI	GCATC	3 cut(s)	349, 670, 782
MaeI	CTAG	3 cut(s)	149, 716, 823
MaeII	ACGT	1 cut(s)	423
MaeIII	GTNAC	1 cut(s)	159
MalI	GATC	3 cut(s)	168, 293, 401
MboI	GATC	3 cut(s)	166, 291, 399
MboII	GAAGA	6 cut(s)	122, 125, 176, 383, 587, 598
MflI	RGATCY	3 cut(s)	166, 291, 399
MhlI	GDGCHC	1 cut(s)	15
MluCI	AATT	3 cut(s)	66, 138, 465
MlyI	GAGTC	1 cut(s)	529
MmeI	TCCRAC	1 cut(s)	532
MnlI	CCTC	3 cut(s)	40, 344, 738
MroXI	GAANNNNTTC	2 cut(s)	183, 412
MseI	TTAA	7 cut(s)	69, 225, 384, 404, 629, 695, 797
MspCI	CTTAAG	2 cut(s)	403, 694
MspI	CCGG	1 cut(s)	790
MspR9I	CCNGG	2 cut(s)	338, 791
Mva1269I	GAATGC	1 cut(s)	279
MvaI	CCWGG	1 cut(s)	338
MwoI	GCNNNNNNNGC	3 cut(s)	10, 680, 770
NciI	CCSGG	1 cut(s)	791
NdeI	CATATG	1 cut(s)	756
NdeII	GATC	3 cut(s)	166, 291, 399
NlaIII	CATG	5 cut(s)	30, 122, 303, 589, 625
NlaIV	GGNNCC	2 cut(s)	293, 765
NmeAIII	GCCGAG	2 cut(s)	257, 768
NsbI	TGCGCA	1 cut(s)	353
NspI	RCATGY	2 cut(s)	589, 625
PaeI	GCATGC	1 cut(s)	589
PctI	GAATGC	1 cut(s)	279
PdmI	GAANNNNTTC	2 cut(s)	183, 412
PfeI	GAWTC	2 cut(s)	19, 413
PflFI	GACNNNGTC	1 cut(s)	125
PflMI	CCANNNNNTGG	2 cut(s)	22, 760
PfoI	TCCNGGA	1 cut(s)	336
PleI	GAGTC	1 cut(s)	528
PpsI	GAGTC	1 cut(s)	528
PpuMI	RGGWCCY	1 cut(s)	340
Psp124BI	GAGCTC	1 cut(s)	15
Psp5II	RGGWCCY	1 cut(s)	340
Psp6I	CCWGG	1 cut(s)	336
PspGI	CCWGG	1 cut(s)	336
PspN4I	GGNNCC	2 cut(s)	293, 765
PspPI	GGNCC	3 cut(s)	340, 428, 787
PspPPI	RGGWCCY	1 cut(s)	340
PstNI	CAGNNNCTG	2 cut(s)	22, 169
PsuI	RGATCY	3 cut(s)	166, 291, 399
PsyI	GACNNNGTC	1 cut(s)	125
RsaI	GTAC	1 cut(s)	422
RsaNI	GTAC	1 cut(s)	421
SacI	GAGCTC	1 cut(s)	15
SaqAI	TTAA	7 cut(s)	69, 225, 384, 404, 629, 695, 797
Sau3AI	GATC	3 cut(s)	166, 291, 399
Sau96I	GGNCC	3 cut(s)	340, 428, 787
SchI	GAGTC	1 cut(s)	529
ScrFI	CCNGG	2 cut(s)	338, 791
SduI	GDGCHC	1 cut(s)	15
SfaNI	GCATC	3 cut(s)	349, 670, 782
SfcI	CTRYAG	1 cut(s)	612
SinI	GGWCC	2 cut(s)	340, 787
SmlI	CTYRAG	3 cut(s)	44, 403, 694
SmoI	CTYRAG	3 cut(s)	44, 403, 694
SphI	GCATGC	1 cut(s)	589
Sse9I	AATT	3 cut(s)	66, 138, 465
SspMI	CTAG	3 cut(s)	149, 716, 823
SstI	GAGCTC	1 cut(s)	15
StyD4I	CCNGG	2 cut(s)	336, 789
TaaI	ACNGT	1 cut(s)	613
TaiI	ACGT	1 cut(s)	426
TaqI	TCGA	3 cut(s)	9, 187, 642
TasI	AATT	3 cut(s)	66, 138, 465
TfiI	GAWTC	2 cut(s)	19, 413
Tru1I	TTAA	7 cut(s)	69, 225, 384, 404, 629, 695, 797
Tru9I	TTAA	7 cut(s)	69, 225, 384, 404, 629, 695, 797
TscAI	CASTG	3 cut(s)	616, 744, 774
TspDTI	ATGAA	4 cut(s)	252, 425, 527, 700
TspRI	CASTG	3 cut(s)	616, 744, 774
Tth111I	GACNNNGTC	1 cut(s)	125
Van91I	CCANNNNNTGG	2 cut(s)	22, 760
Vha464I	CTTAAG	2 cut(s)	403, 694
VpaK11BI	GGWCC	2 cut(s)	340, 787
XceI	RCATGY	2 cut(s)	589, 625
XmnI	GAANNNNTTC	2 cut(s)	183, 412
XspI	CTAG	3 cut(s)	149, 716, 823

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.