Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006651.1

Orthogroup ID

OG0014695

Physical Location & Seq

Genomic Coordinates Forward (+)

26449 .. 26754

Gene Structure 306 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006651.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 306 bp

atggtgcaagtggtgcctctggggttagattgggcttcggctgcctattatggagaaacggtaggtactggaatggggttggaatacttggagtacaaaattaaagcagaggaaagttccctcattgatgtctatggtcctgatcacccagtcattactaatcccgagtctatattcgcgaagggctatgaggctgccagggctgtttatgttgatggccagaatctcaagattaacttggtcaggttcaggaaaacccttgttgaagccatgaaacttctaggacactctacttccgaaaattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00514 ko00515 ko01100 map00514 map00515 map01100

Pfam Domains

Protein Families

DUF563

Protein Analysis

101

Amino Acids

11.14

Weight (kDa)

5.05

Isoelectric Point (pI)

7.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014695)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g23260 FvH4_6g19650
malus_domestica	MD03G1195900.v1.1
prunus_persica	Prupe.4G220000_v2.0.a1
pyrus_communis	pycom03g14810
rosa_chinensis	RchiOBHm_Chr5g0040951
rosa_laevigata	RLG00000034017
rosa_multiflora	Rmu_sc0006651.1_g000006 Rmu_sc0006651.1_g000009
rosa_roxburghii	Rroxscaffold_1G00039740
rosa_rugosa	Rorug05G0189000 Rorug05G0189100 Rorug05G0189200
rosa_samantha	Rh5BG279500 Rh5CG311700 Rh5DG287600
rosa_wichuraiana	Rw5G025800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	13
AccII	CGCG	1 cut(s)	179
AcoI	YGGCCR	1 cut(s)	217
AfaI	GTAC	2 cut(s)	67, 95
AgsI	TTSAA	1 cut(s)	266
AjnI	CCWGG	1 cut(s)	197
Ama87I	CYCGRG	1 cut(s)	164
AoxI	GGCC	1 cut(s)	217
ApeKI	GCWGC	2 cut(s)	41, 194
AspS9I	GGNCC	1 cut(s)	137
AsuHPI	GGTGA	1 cut(s)	137
AvaI	CYCGRG	1 cut(s)	164
AvaII	GGWCC	1 cut(s)	137
BalI	TGGCCA	1 cut(s)	219
BanI	GGYRCC	1 cut(s)	13
BbvI	GCAGC	2 cut(s)	28, 181
BccI	CCATC	1 cut(s)	209
BciT130I	CCWGG	1 cut(s)	199
BclI	TGATCA	1 cut(s)	142
BfaI	CTAG	1 cut(s)	281
BisI	GCNGC	2 cut(s)	42, 195
BlsI	GCNGC	2 cut(s)	43, 196
Bme1390I	CCNGG	1 cut(s)	199
Bme18I	GGWCC	1 cut(s)	137
BmeT110I	CYCGRG	1 cut(s)	164
BmgT120I	GGNCC	1 cut(s)	137
BmiI	GGNNCC	1 cut(s)	15
BmrFI	CCNGG	1 cut(s)	199
BmrI	ACTGGG	1 cut(s)	143
BmuI	ACTGGG	1 cut(s)	143
BpuEI	CTTGAG	1 cut(s)	212
BsaJI	CCNNGG	1 cut(s)	198
BsaXI	ACNNNNNCTCC	2 cut(s)	45, 75
Bse1I	ACTGG	2 cut(s)	73, 149
BseBI	CCWGG	1 cut(s)	199
BseDI	CCNNGG	1 cut(s)	198
BseNI	ACTGG	2 cut(s)	73, 149
BseXI	GCAGC	2 cut(s)	28, 181
Bsh1236I	CGCG	1 cut(s)	179
BshFI	GGCC	1 cut(s)	219
BshNI	GGYRCC	1 cut(s)	13
BsiHKCI	CYCGRG	1 cut(s)	164
BsnI	GGCC	1 cut(s)	219
BsoBI	CYCGRG	1 cut(s)	164
Bsp143I	GATC	1 cut(s)	142
Bsp68I	TCGCGA	1 cut(s)	179
BspANI	GGCC	1 cut(s)	219
BspFNI	CGCG	1 cut(s)	179
BspLI	GGNNCC	1 cut(s)	15
BspT107I	GGYRCC	1 cut(s)	13
BsrI	ACTGG	2 cut(s)	73, 149
BssECI	CCNNGG	1 cut(s)	198
BssMI	GATC	1 cut(s)	142
Bst2UI	CCWGG	1 cut(s)	199
Bst4CI	ACNGT	1 cut(s)	61
BstAPI	GCANNNNNTGC	1 cut(s)	13
BstFNI	CGCG	1 cut(s)	179
BstKTI	GATC	1 cut(s)	145
BstMBI	GATC	1 cut(s)	142
BstMWI	GCNNNNNNNGC	3 cut(s)	13, 41, 200
BstNI	CCWGG	1 cut(s)	199
BstSCI	CCNGG	1 cut(s)	197
BstUI	CGCG	1 cut(s)	179
BstV1I	GCAGC	2 cut(s)	28, 181
BsuRI	GGCC	1 cut(s)	219
BtuMI	TCGCGA	1 cut(s)	179
Cfr13I	GGNCC	1 cut(s)	137
Csp6I	GTAC	2 cut(s)	66, 94
CviAII	CATG	1 cut(s)	271
CviJI	RGCY	7 cut(s)	35, 41, 186, 194, 203, 219, 269
CviKI_1	RGCY	7 cut(s)	35, 41, 186, 194, 203, 219, 269
CviQI	GTAC	2 cut(s)	66, 94
DpnI	GATC	1 cut(s)	144
DpnII	GATC	1 cut(s)	142
EaeI	YGGCCR	1 cut(s)	217
Eco47I	GGWCC	1 cut(s)	137
Eco88I	CYCGRG	1 cut(s)	164
EcoRII	CCWGG	1 cut(s)	197
FaeI	CATG	1 cut(s)	274
FaiI	YATR	6 cut(s)	51, 135, 173, 189, 210, 272
FalI	AAGNNNNNCTT	2 cut(s)	221, 253
FatI	CATG	1 cut(s)	270
FbaI	TGATCA	1 cut(s)	142
Fnu4HI	GCNGC	2 cut(s)	42, 195
Fsp4HI	GCNGC	2 cut(s)	42, 195
FspBI	CTAG	1 cut(s)	281
GluI	GCNGC	2 cut(s)	42, 195
HaeIII	GGCC	1 cut(s)	219
Hin1II	CATG	1 cut(s)	274
HinfI	GANTC	2 cut(s)	167, 223
HphI	GGTGA	1 cut(s)	137
Hpy188I	TCNGA	1 cut(s)	298
Hpy188III	TCNNGA	5 cut(s)	140, 164, 178, 229, 250
HpyAV	CCTTC	1 cut(s)	175
HpyCH4III	ACNGT	1 cut(s)	61
HpyCH4V	TGCA	1 cut(s)	7
HpyF10VI	GCNNNNNNNGC	3 cut(s)	13, 41, 200
Hsp92II	CATG	1 cut(s)	274
Ksp22I	TGATCA	1 cut(s)	142
Kzo9I	GATC	1 cut(s)	142
LpnPI	CCDG	9 cut(s)	5, 54, 153, 162, 184, 211, 229, 233, 235
Lsp1109I	GCAGC	2 cut(s)	28, 181
MaeI	CTAG	1 cut(s)	281
MalI	GATC	1 cut(s)	144
MboI	GATC	1 cut(s)	142
MlsI	TGGCCA	1 cut(s)	219
MluCI	AATT	2 cut(s)	99, 301
MluNI	TGGCCA	1 cut(s)	219
MlyI	GAGTC	1 cut(s)	176
MmeI	TCCRAC	1 cut(s)	60
MnlI	CCTC	4 cut(s)	27, 103, 131, 184
Mox20I	TGGCCA	1 cut(s)	219
MscI	TGGCCA	1 cut(s)	219
MseI	TTAA	2 cut(s)	102, 234
Msp20I	TGGCCA	1 cut(s)	219
MspR9I	CCNGG	1 cut(s)	199
MvaI	CCWGG	1 cut(s)	199
MvnI	CGCG	1 cut(s)	179
MwoI	GCNNNNNNNGC	3 cut(s)	13, 41, 200
NdeII	GATC	1 cut(s)	142
NlaIII	CATG	1 cut(s)	274
NlaIV	GGNNCC	1 cut(s)	15
NruI	TCGCGA	1 cut(s)	179
PfeI	GAWTC	1 cut(s)	223
PkrI	GCNGC	2 cut(s)	43, 196
PleI	GAGTC	1 cut(s)	175
PpsI	GAGTC	1 cut(s)	175
Psp6I	CCWGG	1 cut(s)	197
PspGI	CCWGG	1 cut(s)	197
PspN4I	GGNNCC	1 cut(s)	15
PspPI	GGNCC	1 cut(s)	137
RruI	TCGCGA	1 cut(s)	179
RsaI	GTAC	2 cut(s)	67, 95
RsaNI	GTAC	2 cut(s)	66, 94
SaqAI	TTAA	2 cut(s)	102, 234
SatI	GCNGC	2 cut(s)	42, 195
Sau3AI	GATC	1 cut(s)	142
Sau96I	GGNCC	1 cut(s)	137
SchI	GAGTC	1 cut(s)	176
ScrFI	CCNGG	1 cut(s)	199
SetI	ASST	2 cut(s)	67, 248
SinI	GGWCC	1 cut(s)	137
SmlI	CTYRAG	1 cut(s)	227
SmoI	CTYRAG	1 cut(s)	227
Sse9I	AATT	2 cut(s)	99, 301
SspMI	CTAG	1 cut(s)	281
StyD4I	CCNGG	1 cut(s)	197
TaaI	ACNGT	1 cut(s)	61
TasI	AATT	2 cut(s)	99, 301
TatI	WGTACW	1 cut(s)	93
TfiI	GAWTC	1 cut(s)	223
Tru1I	TTAA	2 cut(s)	102, 234
Tru9I	TTAA	2 cut(s)	102, 234
TseI	GCWGC	2 cut(s)	41, 194
TspDTI	ATGAA	1 cut(s)	287
VpaK11BI	GGWCC	1 cut(s)	137
XspI	CTAG	1 cut(s)	281

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.