Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006867.1

Orthogroup ID

OG0009066

Physical Location & Seq

Genomic Coordinates Forward (+)

154002 .. 155420

Gene Structure 1419 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006867.1_g000032.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1140 bp

atgatatccttgttcgggttatcgaatgcagccgcaacttataatgtgatgaaatatggtgcaaaagcagatgggaaaacagactcaacccaagcatttgtcaagacatgggcagcagcatgcagctctgctcagacatccaccatgtacgtccccaaaggaagtttcttgctgaaagctgcagtgttcagaggcccttgcaagagtagaattatcgttcagatatacggaaccctgattgcccctactgattattgggctttgggaaactccggtcactggatcttgttcattaaggtcaatagacttgaagttttcggtggtagactcgacgccaagggagctggcttttgggcttgcaggaaatccggaaagagctgccctgttggagctaggtcgataacgttcaattgggcaaatgacgttgtgataagtggtttatcatccgtcaacagtcagttaactcatcttgtgatcaacagctgcaacaatgtggctgtccgaaacgttacgctgtatgctccggatgacagccccaacactgacggcattcatgtgcagggctcaactggggttactatcactggtgcaaccttgatgaccggagacgattgtgtatcaattggtcctggaaccaaaaacctgtacatgagtaacatcaggtgcggcccaggacatggcgtaagcattggtagtctaggcagggcagtgaacgaagctggggtccaaaatgtgacgttgacgaatgcagttttcaccggatcggacaatggagtacgaataaagtcatgggcgaggcccagcactgggtttgtgaccaacattctcttccagaacatcatgatgaggaacgttgagaaccccatcatcatcaatcagaactattgcccacataaccaaggttgccctaaccagagttctggtgtgaagattagtcaagtaacatataagaatatacaagggacgtcggcaacggcggaggcggtgacatttgactgcagcccaagtaatccgtgcagagggattagattgcatgacatcaagcttacatacctgaataaggtagccacatcttcatgcaataacattggtggaaccagcaccggagtagtcatgcccaggagttgcttgagaagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00040 ko01100 map00040 map01100

Pfam Domains

Protein Families

Glyco_hydro_28

Protein Analysis

379

Amino Acids

40.23

Weight (kDa)

9.42

Isoelectric Point (pI)

32.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009066)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G43890
fragaria_vesca	FvH4_1g00260 FvH4_7g26550
malus_domestica	MD00G1087800.v1.1 MD15G1143800.v1.1
prunus_persica	Prupe.7G269400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0084561 RchiOBHm_Chr2g0149621
rosa_laevigata	RLG00000015627 RLG00000020431
rosa_multiflora	Rmu_sc0006867.1_g000032
rosa_roxburghii	Rroxscaffold_2G00097870 Rroxscaffold_2G00155960
rosa_rugosa	Rorug01G0455100 Rorug02G0413500
rosa_samantha	Rh2BG485700 Rh2CG003200 Rh2DG003200
rosa_wichuraiana	Rw2G000280 Rw2G038630 Rw7G041010 Rw7G041030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	42
AatII	GACGTC	1 cut(s)	968
AccB7I	CCANNNNNTGG	1 cut(s)	677
AccI	GTMKAC	1 cut(s)	325
AccIII	TCCGGA	2 cut(s)	368, 523
AciI	CCGC	4 cut(s)	33, 666, 977, 983
AclI	AACGTT	3 cut(s)	404, 507, 852
AclWI	GGATC	2 cut(s)	290, 769
AcyI	GRCGYC	2 cut(s)	333, 965
AfaI	GTAC	3 cut(s)	149, 647, 777
AfiI	CCNNNNNNNGG	7 cut(s)	15, 279, 677, 806, 807, 1019, 1060
AgsI	TTSAA	2 cut(s)	311, 409
AjnI	CCWGG	3 cut(s)	628, 670, 1118
AjuI	GAANNNNNNNTTGG	4 cut(s)	149, 181, 812, 844
AluBI	AGCT	8 cut(s)	126, 179, 344, 378, 392, 483, 719, 1045
AluI	AGCT	8 cut(s)	126, 179, 344, 378, 392, 483, 719, 1045
Alw26I	GTCTC	1 cut(s)	600
AlwI	GGATC	2 cut(s)	290, 769
Aor13HI	TCCGGA	2 cut(s)	368, 523
AoxI	GGCC	3 cut(s)	193, 667, 797
ApeKI	GCWGC	8 cut(s)	29, 113, 116, 123, 179, 378, 483, 999
ArsI	GACNNNNNNTTYG	2 cut(s)	708, 740
AspS9I	GGNCC	5 cut(s)	194, 626, 668, 724, 798
AsuHPI	GGTGA	2 cut(s)	748, 997
AvaII	GGWCC	2 cut(s)	626, 724
BanII	GRGCYC	1 cut(s)	566
BbvI	GCAGC	8 cut(s)	41, 125, 128, 135, 166, 365, 470, 1011
BccI	CCATC	2 cut(s)	65, 872
BceAI	ACGGC	2 cut(s)	562, 990
BciT130I	CCWGG	3 cut(s)	630, 672, 1120
BclI	TGATCA	1 cut(s)	474
BcoDI	GTCTC	1 cut(s)	600
BfaI	CTAG	2 cut(s)	393, 698
BfmI	CTRYAG	2 cut(s)	180, 997
Bme1390I	CCNGG	3 cut(s)	630, 672, 1120
Bme18I	GGWCC	2 cut(s)	626, 724
BmgT120I	GGNCC	5 cut(s)	194, 626, 668, 724, 798
BmiI	GGNNCC	4 cut(s)	232, 634, 725, 1096
BmrFI	CCNGG	3 cut(s)	630, 672, 1120
BmrI	ACTGGG	2 cut(s)	579, 816
BmuI	ACTGGG	2 cut(s)	579, 816
BsaHI	GRCGYC	2 cut(s)	333, 965
BsaJI	CCNNGG	4 cut(s)	336, 670, 898, 1118
BsaWI	WCCGGW	6 cut(s)	272, 368, 523, 602, 758, 1103
Bsc4I	CCNNNNNNNGG	7 cut(s)	15, 279, 677, 806, 807, 1019, 1060
Bse1I	ACTGG	4 cut(s)	284, 574, 589, 811
BseAI	TCCGGA	2 cut(s)	368, 523
BseBI	CCWGG	3 cut(s)	630, 672, 1120
BseDI	CCNNGG	4 cut(s)	336, 670, 898, 1118
BseGI	GGATG	3 cut(s)	137, 443, 532
BseLI	CCNNNNNNNGG	7 cut(s)	15, 279, 677, 806, 807, 1019, 1060
BseMII	CTCAG	1 cut(s)	146
BseNI	ACTGG	4 cut(s)	284, 574, 589, 811
BseXI	GCAGC	8 cut(s)	41, 125, 128, 135, 166, 365, 470, 1011
BseYI	CCCAGC	2 cut(s)	719, 800
BsgI	GTGCAG	2 cut(s)	578, 1036
BshFI	GGCC	3 cut(s)	195, 669, 799
BsiSI	CCGG	6 cut(s)	273, 369, 524, 603, 759, 1104
BslFI	GGGAC	2 cut(s)	137, 976
BslI	CCNNNNNNNGG	7 cut(s)	15, 279, 677, 806, 807, 1019, 1060
BsmAI	GTCTC	1 cut(s)	600
BsmBI	CGTCTC	1 cut(s)	600
BsmFI	GGGAC	2 cut(s)	137, 976
BsmI	GAATGC	3 cut(s)	31, 549, 751
BsnI	GGCC	3 cut(s)	195, 669, 799
Bsp1286I	GDGCHC	1 cut(s)	566
Bsp13I	TCCGGA	2 cut(s)	368, 523
Bsp1407I	TGTACA	1 cut(s)	645
Bsp143I	GATC	3 cut(s)	282, 474, 761
BspACI	CCGC	4 cut(s)	33, 666, 977, 983
BspANI	GGCC	3 cut(s)	195, 669, 799
BspCNI	CTCAG	1 cut(s)	145
BspEI	TCCGGA	2 cut(s)	368, 523
BspHI	TCATGA	1 cut(s)	840
BspLI	GGNNCC	4 cut(s)	232, 634, 725, 1096
BspMAI	CTGCAG	2 cut(s)	184, 1001
BspPI	GGATC	2 cut(s)	290, 769
BsrGI	TGTACA	1 cut(s)	645
BsrI	ACTGG	4 cut(s)	284, 574, 589, 811
BssECI	CCNNGG	4 cut(s)	336, 670, 898, 1118
BssMI	GATC	3 cut(s)	282, 474, 761
BssNI	GRCGYC	2 cut(s)	333, 965
BssT1I	CCWWGG	2 cut(s)	336, 898
Bst2UI	CCWGG	3 cut(s)	630, 672, 1120
Bst4CI	ACNGT	1 cut(s)	455
Bst6I	CTCTTC	1 cut(s)	833
BstACI	GRCGYC	2 cut(s)	333, 965
BstAUI	TGTACA	1 cut(s)	645
BstC8I	GCNNGC	3 cut(s)	121, 346, 358
BstDEI	CTNAG	1 cut(s)	132
BstENI	CCTNNNNNAGG	1 cut(s)	1058
BstF5I	GGATG	3 cut(s)	137, 443, 532
BstKTI	GATC	3 cut(s)	285, 477, 764
BstMAI	GTCTC	1 cut(s)	600
BstMBI	GATC	3 cut(s)	282, 474, 761
BstMWI	GCNNNNNNNGC	1 cut(s)	341
BstNI	CCWGG	3 cut(s)	630, 672, 1120
BstNSI	RCATGY	1 cut(s)	123
BstSCI	CCNGG	3 cut(s)	628, 670, 1118
BstSFI	CTRYAG	2 cut(s)	180, 997
BstV1I	GCAGC	8 cut(s)	41, 125, 128, 135, 166, 365, 470, 1011
BstX2I	RGATCY	1 cut(s)	282
BstXI	CCANNNNNNTGG	1 cut(s)	920
BstYI	RGATCY	1 cut(s)	282
BsuRI	GGCC	3 cut(s)	195, 669, 799
BtsCI	GGATG	3 cut(s)	137, 443, 532
BtsI	GCAGTG	2 cut(s)	189, 714
BtsIMutI	CAGTG	6 cut(s)	189, 277, 540, 582, 714, 804
Cac8I	GCNNGC	3 cut(s)	121, 346, 358
CciI	TCATGA	1 cut(s)	840
Cfr13I	GGNCC	5 cut(s)	194, 626, 668, 724, 798
CseI	GACGC	1 cut(s)	341
Csp6I	GTAC	3 cut(s)	148, 646, 776
CviQI	GTAC	3 cut(s)	148, 646, 776
DdeI	CTNAG	1 cut(s)	132
DpnI	GATC	3 cut(s)	284, 476, 763
DpnII	GATC	3 cut(s)	282, 474, 761
Eam1104I	CTCTTC	1 cut(s)	833
EarI	CTCTTC	1 cut(s)	833
EciI	GGCGGA	1 cut(s)	992
Eco130I	CCWWGG	2 cut(s)	336, 898
Eco24I	GRGCYC	1 cut(s)	566
Eco32I	GATATC	1 cut(s)	6
Eco47I	GGWCC	2 cut(s)	626, 724
EcoNI	CCTNNNNNAGG	1 cut(s)	1058
EcoO109I	RGGNCCY	1 cut(s)	194
EcoRII	CCWGG	3 cut(s)	628, 670, 1118
EcoRV	GATATC	1 cut(s)	6
EcoT14I	CCWWGG	2 cut(s)	336, 898
EcoT38I	GRGCYC	1 cut(s)	566
ErhI	CCWWGG	2 cut(s)	336, 898
Esp3I	CGTCTC	1 cut(s)	600
FaqI	GGGAC	2 cut(s)	137, 976
FbaI	TGATCA	1 cut(s)	474
FblI	GTMKAC	1 cut(s)	325
FokI	GGATG	3 cut(s)	124, 430, 539
FriOI	GRGCYC	1 cut(s)	566
FspBI	CTAG	2 cut(s)	393, 698
GsaI	CCCAGC	2 cut(s)	723, 804
HaeIII	GGCC	3 cut(s)	195, 669, 799
HapII	CCGG	6 cut(s)	273, 369, 524, 603, 759, 1104
HgaI	GACGC	1 cut(s)	341
Hin1I	GRCGYC	2 cut(s)	333, 965
HincII	GTYRAC	3 cut(s)	451, 462, 741
HindII	GTYRAC	3 cut(s)	451, 462, 741
HindIII	AAGCTT	1 cut(s)	1043
HinfI	GANTC	2 cut(s)	83, 327
HpaI	GTTAAC	1 cut(s)	462
HpaII	CCGG	6 cut(s)	273, 369, 524, 603, 759, 1104
HphI	GGTGA	2 cut(s)	748, 997
Hpy166II	GTNNAC	5 cut(s)	326, 451, 462, 712, 741
Hpy188I	TCNGA	6 cut(s)	135, 191, 222, 503, 766, 879
Hpy188III	TCNNGA	5 cut(s)	103, 369, 524, 832, 841
Hpy8I	GTNNAC	5 cut(s)	326, 451, 462, 712, 741
Hpy99I	CGWCG	2 cut(s)	335, 970
HpyCH4III	ACNGT	1 cut(s)	455
HpyCH4IV	ACGT	7 cut(s)	150, 404, 423, 507, 737, 852, 965
HpyF10VI	GCNNNNNNNGC	1 cut(s)	341
HpyF3I	CTNAG	1 cut(s)	132
HpySE526I	ACGT	7 cut(s)	150, 404, 423, 507, 737, 852, 965
Hsp92I	GRCGYC	2 cut(s)	333, 965
Kpn2I	TCCGGA	2 cut(s)	368, 523
Ksp22I	TGATCA	1 cut(s)	474
KspAI	GTTAAC	1 cut(s)	462
Kzo9I	GATC	3 cut(s)	282, 474, 761
LmnI	GCTCC	3 cut(s)	341, 389, 526
Lsp1109I	GCAGC	8 cut(s)	41, 125, 128, 135, 166, 365, 470, 1011
MaeI	CTAG	2 cut(s)	393, 698
MaeII	ACGT	7 cut(s)	150, 404, 423, 507, 737, 852, 965
MaeIII	GTNAC	8 cut(s)	275, 508, 574, 653, 733, 814, 940, 985
MalI	GATC	3 cut(s)	284, 476, 763
MboI	GATC	3 cut(s)	282, 474, 761
MboII	GAAGA	3 cut(s)	820, 940, 1065
MfeI	CAATTG	2 cut(s)	409, 621
MflI	RGATCY	1 cut(s)	282
MhlI	GDGCHC	1 cut(s)	566
MluCI	AATT	3 cut(s)	210, 409, 621
MlyI	GAGTC	2 cut(s)	77, 321
MmeI	TCCRAC	1 cut(s)	367
MnlI	CCTC	5 cut(s)	185, 789, 840, 973, 1013
MroI	TCCGGA	2 cut(s)	368, 523
MseI	TTAA	2 cut(s)	294, 461
MslI	CAYNNNNRTG	3 cut(s)	554, 842, 1075
MspA1I	CMGCKG	1 cut(s)	483
MspI	CCGG	6 cut(s)	273, 369, 524, 603, 759, 1104
MspR9I	CCNGG	3 cut(s)	630, 672, 1120
MunI	CAATTG	2 cut(s)	409, 621
Mva1269I	GAATGC	3 cut(s)	31, 549, 751
MvaI	CCWGG	3 cut(s)	630, 672, 1120
MwoI	GCNNNNNNNGC	1 cut(s)	341
NdeII	GATC	3 cut(s)	282, 474, 761
NlaIV	GGNNCC	4 cut(s)	232, 634, 725, 1096
NmuCI	GTSAC	4 cut(s)	275, 733, 814, 985
NspI	RCATGY	1 cut(s)	123
PaeI	GCATGC	1 cut(s)	123
PagI	TCATGA	1 cut(s)	840
PctI	GAATGC	3 cut(s)	31, 549, 751
PflMI	CCANNNNNTGG	1 cut(s)	677
PfoI	TCCNGGA	1 cut(s)	628
PleI	GAGTC	2 cut(s)	77, 321
PpsI	GAGTC	2 cut(s)	77, 321
PsiI	TTATAA	1 cut(s)	42
Psp1406I	AACGTT	3 cut(s)	404, 507, 852
Psp6I	CCWGG	3 cut(s)	628, 670, 1118
PspFI	CCCAGC	2 cut(s)	719, 800
PspGI	CCWGG	3 cut(s)	628, 670, 1118
PspN4I	GGNNCC	4 cut(s)	232, 634, 725, 1096
PspPI	GGNCC	5 cut(s)	194, 626, 668, 724, 798
PstI	CTGCAG	2 cut(s)	184, 1001
PsuI	RGATCY	1 cut(s)	282
PvuII	CAGCTG	1 cut(s)	483
RsaI	GTAC	3 cut(s)	149, 647, 777
RsaNI	GTAC	3 cut(s)	148, 646, 776
RseI	CAYNNNNRTG	3 cut(s)	554, 842, 1075
SaqAI	TTAA	2 cut(s)	294, 461
Sau3AI	GATC	3 cut(s)	282, 474, 761
Sau96I	GGNCC	5 cut(s)	194, 626, 668, 724, 798
SchI	GAGTC	2 cut(s)	77, 321
ScrFI	CCNGG	3 cut(s)	630, 672, 1120
SduI	GDGCHC	1 cut(s)	566
SfcI	CTRYAG	2 cut(s)	180, 997
SinI	GGWCC	2 cut(s)	626, 724
SmiMI	CAYNNNNRTG	3 cut(s)	554, 842, 1075
SmlI	CTYRAG	1 cut(s)	1129
SmoI	CTYRAG	1 cut(s)	1129
SphI	GCATGC	1 cut(s)	123
Sse9I	AATT	3 cut(s)	210, 409, 621
SsiI	CCGC	4 cut(s)	33, 666, 977, 983
SspMI	CTAG	2 cut(s)	393, 698
StyD4I	CCNGG	3 cut(s)	628, 670, 1118
StyI	CCWWGG	2 cut(s)	336, 898
TaaI	ACNGT	1 cut(s)	455
TaiI	ACGT	7 cut(s)	153, 407, 426, 510, 740, 855, 968
TaqI	TCGA	3 cut(s)	23, 330, 398
TasI	AATT	3 cut(s)	210, 409, 621
TatI	WGTACW	1 cut(s)	645
TauI	GCSGC	2 cut(s)	35, 669
Tru1I	TTAA	2 cut(s)	294, 461
Tru9I	TTAA	2 cut(s)	294, 461
TscAI	CASTG	6 cut(s)	189, 284, 547, 589, 714, 811
TseFI	GTSAC	4 cut(s)	275, 733, 814, 985
TseI	GCWGC	8 cut(s)	29, 113, 116, 123, 179, 378, 483, 999
Tsp45I	GTSAC	4 cut(s)	275, 733, 814, 985
TspDTI	ATGAA	4 cut(s)	65, 280, 542, 1065
TspGWI	ACGGA	3 cut(s)	243, 436, 1002
TspRI	CASTG	6 cut(s)	189, 284, 547, 589, 714, 811
Van91I	CCANNNNNTGG	1 cut(s)	677
VpaK11BI	GGWCC	2 cut(s)	626, 724
XagI	CCTNNNNNAGG	1 cut(s)	1058
XceI	RCATGY	1 cut(s)	123
XmiI	GTMKAC	1 cut(s)	325
XspI	CTAG	2 cut(s)	393, 698
ZraI	GACGTC	1 cut(s)	966

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.