Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007274.1

Orthogroup ID

OG0009508

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 8314

Gene Structure 8314 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007274.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 898 bp

agatggtgctgtggaatgttttgacttgagaatgaaatcttcagttggtaggattaatgctgttggacctgctggtgacattgaccaggaggtcacagcagtagagtttgatgaaaaaacgggtttcttaatggctgttggaagcagtgcagggaaggttctcgtctatgacttgcgttcatcacatcctatacaggtgaaggatcacatgtatggcagtccgatattagacattaagtggcatcaaactcttaattctgaacggccaaagttaattaccactgacaatcacgttgttagaatatgggaccctgacacaggagaaggaatgacaagcattgagcccacagctggagcaataaatgatatatgtacattccctggcagtggattgatgctgttggctctggactccagtcagataccatcgtatttcatacctgaactcggacctgctccaaattggtgttcttacctgcaaaatcttactgaagagttagaggagggtgcgcagacgaccatctatgatgattataaatttttgacaaaagaagaccttgagaggttgaggttgactaagctgattggaacgaatctactcagagcttacatgcatgggttctttgttcgttattcgttgtataaaaaggcaaaagctttggtagagccttttgatattagtgaatacattgaacagcagaaaaaggagaagctagaaaaagaatttgctggacagcgaattacgagtctggaggaggatgggcttgaaatactgaatgcttcttcttttgagtcctctggagggagggtcttctataatttacatctccaggtagatatgttccataggttggaatgtgagaatttaagcgagaagcttatgtccttctatgcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUC153

Protein Analysis

298

Amino Acids

33.62

Weight (kDa)

4.84

Isoelectric Point (pI)

52.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009508)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G56990 AT3G56990 AT3G56990
fragaria_vesca	FvH4_2g11640 FvH4_2g11640
malus_domestica	MD06G1011700.v1.1
prunus_persica	Prupe.5G014500_v2.0.a1 Prupe.5G014500_v2.0.a1 Prupe.8G004300_v2.0.a1
pyrus_communis	pycom06g00990
rosa_chinensis	RchiOBHm_Chr6g0270881
rosa_laevigata	RLG00000013762
rosa_multiflora	Rmu_sc0000642.1_g000031 Rmu_sc0007274.1_g000001
rosa_roxburghii	Rroxscaffold_7G00197520
rosa_rugosa	Rorug06G0056900 Rorug06G0057000
rosa_samantha	Rh6AG176500 Rh6BG179900 Rh6CG175900 Rh6DG168200
rosa_wichuraiana	Rw6G015040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	535
AasI	GACNNNNNNGTC	1 cut(s)	90
Acc16I	TGCGCA	1 cut(s)	511
Acc36I	ACCTGC	3 cut(s)	77, 461, 484
AccB7I	CCANNNNNTGG	1 cut(s)	851
AclWI	GGATC	1 cut(s)	211
AcoI	YGGCCR	1 cut(s)	264
AcsI	RAATTY	3 cut(s)	537, 723, 863
AcuI	CTGAAG	2 cut(s)	25, 511
AfaI	GTAC	1 cut(s)	374
AfiI	CCNNNNNNNGG	6 cut(s)	318, 351, 387, 447, 802, 851
AflIII	ACRYGT	1 cut(s)	208
AgsI	TTSAA	2 cut(s)	693, 768
AjnI	CCWGG	3 cut(s)	85, 380, 829
AjuI	GAANNNNNNNTTGG	2 cut(s)	452, 484
AluBI	AGCT	6 cut(s)	351, 581, 606, 657, 713, 878
AluI	AGCT	6 cut(s)	351, 581, 606, 657, 713, 878
AlwI	GGATC	1 cut(s)	211
AoxI	GGCC	1 cut(s)	264
ApoI	RAATTY	3 cut(s)	537, 723, 863
ArsI	GACNNNNNNTTYG	2 cut(s)	731, 763
AseI	ATTAAT	1 cut(s)	55
AspLEI	GCGC	1 cut(s)	512
AspS9I	GGNCC	3 cut(s)	66, 308, 450
AsuHPI	GGTGA	2 cut(s)	87, 209
AvaII	GGWCC	3 cut(s)	66, 308, 450
BaeI	ACNNNNGTAYC	2 cut(s)	414, 447
BanII	GRGCYC	1 cut(s)	346
BbsI	GAAGAC	2 cut(s)	559, 803
BccI	CCATC	3 cut(s)	434, 528, 753
BceAI	ACGGC	1 cut(s)	279
BciT130I	CCWGG	3 cut(s)	87, 382, 831
BfaI	CTAG	1 cut(s)	714
BfuAI	ACCTGC	3 cut(s)	77, 461, 484
Bme1390I	CCNGG	3 cut(s)	87, 382, 831
Bme18I	GGWCC	3 cut(s)	66, 308, 450
BmgT120I	GGNCC	3 cut(s)	66, 308, 450
BmiI	GGNNCC	2 cut(s)	309, 310
BmrFI	CCNGG	3 cut(s)	87, 382, 831
BmsI	GCATC	2 cut(s)	251, 385
BoxI	GACNNNNGTC	1 cut(s)	415
BpiI	GAAGAC	2 cut(s)	559, 803
BpmI	CTGGAG	5 cut(s)	373, 398, 771, 813, 820
BpuEI	CTTGAG	2 cut(s)	47, 579
BsaJI	CCNNGG	1 cut(s)	380
BsaXI	ACNNNNNCTCC	2 cut(s)	793, 823
Bsc4I	CCNNNNNNNGG	6 cut(s)	318, 351, 387, 447, 802, 851
Bse1I	ACTGG	1 cut(s)	415
BseBI	CCWGG	3 cut(s)	87, 382, 831
BseDI	CCNNGG	1 cut(s)	380
BseGI	GGATG	2 cut(s)	185, 764
BseLI	CCNNNNNNNGG	6 cut(s)	318, 351, 387, 447, 802, 851
BseMII	CTCAG	1 cut(s)	614
BseNI	ACTGG	1 cut(s)	415
BseRI	GAGGAG	2 cut(s)	516, 768
BsgI	GTGCAG	1 cut(s)	169
BshFI	GGCC	1 cut(s)	266
BslFI	GGGAC	1 cut(s)	321
BslI	CCNNNNNNNGG	6 cut(s)	318, 351, 387, 447, 802, 851
BsmFI	GGGAC	1 cut(s)	321
BsmI	GAATGC	1 cut(s)	782
BsnI	GGCC	1 cut(s)	266
Bsp1286I	GDGCHC	1 cut(s)	346
Bsp1407I	TGTACA	1 cut(s)	372
Bsp143I	GATC	1 cut(s)	203
BspANI	GGCC	1 cut(s)	266
BspCNI	CTCAG	1 cut(s)	613
BspLI	GGNNCC	2 cut(s)	309, 310
BspMI	ACCTGC	3 cut(s)	77, 461, 484
BspPI	GGATC	1 cut(s)	211
BsrGI	TGTACA	1 cut(s)	372
BsrI	ACTGG	1 cut(s)	415
BssECI	CCNNGG	1 cut(s)	380
BssMI	GATC	1 cut(s)	203
Bst2UI	CCWGG	3 cut(s)	87, 382, 831
Bst6I	CTCTTC	1 cut(s)	487
BstAUI	TGTACA	1 cut(s)	372
BstDEI	CTNAG	2 cut(s)	577, 600
BstENI	CCTNNNNNAGG	1 cut(s)	316
BstF5I	GGATG	2 cut(s)	185, 764
BstHHI	GCGC	1 cut(s)	512
BstKTI	GATC	1 cut(s)	206
BstMBI	GATC	1 cut(s)	203
BstNI	CCWGG	3 cut(s)	87, 382, 831
BstNSI	RCATGY	2 cut(s)	212, 614
BstPAI	GACNNNNGTC	1 cut(s)	415
BstSCI	CCNGG	3 cut(s)	85, 380, 829
BstV2I	GAAGAC	2 cut(s)	559, 803
BsuRI	GGCC	1 cut(s)	266
BtsCI	GGATG	2 cut(s)	185, 764
BtsI	GCAGTG	2 cut(s)	152, 392
BtsIMutI	CAGTG	3 cut(s)	152, 280, 392
BveI	ACCTGC	3 cut(s)	77, 461, 484
CfoI	GCGC	1 cut(s)	512
Cfr13I	GGNCC	3 cut(s)	66, 308, 450
Csp6I	GTAC	1 cut(s)	373
CviAII	CATG	3 cut(s)	209, 611, 615
CviQI	GTAC	1 cut(s)	373
DdeI	CTNAG	2 cut(s)	577, 600
DpnI	GATC	1 cut(s)	205
DpnII	GATC	1 cut(s)	203
DrdI	GACNNNNNNGTC	1 cut(s)	90
DseDI	GACNNNNNNGTC	1 cut(s)	90
EaeI	YGGCCR	1 cut(s)	264
Eam1104I	CTCTTC	1 cut(s)	487
EarI	CTCTTC	1 cut(s)	487
Eco24I	GRGCYC	1 cut(s)	346
Eco47I	GGWCC	3 cut(s)	66, 308, 450
Eco57I	CTGAAG	2 cut(s)	25, 511
EcoNI	CCTNNNNNAGG	1 cut(s)	316
EcoO109I	RGGNCCY	1 cut(s)	308
EcoRII	CCWGG	3 cut(s)	85, 380, 829
EcoT22I	ATGCAT	2 cut(s)	616, 896
EcoT38I	GRGCYC	1 cut(s)	346
FaeI	CATG	3 cut(s)	212, 614, 618
FalI	AAGNNNNNCTT	2 cut(s)	541, 573
FaqI	GGGAC	1 cut(s)	321
FatI	CATG	3 cut(s)	208, 610, 614
FokI	GGATG	2 cut(s)	172, 771
FriOI	GRGCYC	1 cut(s)	346
FspBI	CTAG	1 cut(s)	714
FspI	TGCGCA	1 cut(s)	511
GlaI	GCGC	1 cut(s)	511
GsuI	CTGGAG	5 cut(s)	373, 398, 771, 813, 820
HaeIII	GGCC	1 cut(s)	266
HhaI	GCGC	1 cut(s)	512
Hin1II	CATG	3 cut(s)	212, 614, 618
Hin6I	GCGC	1 cut(s)	510
HinP1I	GCGC	1 cut(s)	510
HincII	GTYRAC	1 cut(s)	574
HindII	GTYRAC	1 cut(s)	574
HindIII	AAGCTT	2 cut(s)	655, 876
HinfI	GANTC	4 cut(s)	411, 593, 746, 792
HphI	GGTGA	2 cut(s)	87, 209
Hpy166II	GTNNAC	1 cut(s)	574
Hpy188I	TCNGA	5 cut(s)	223, 260, 421, 450, 603
Hpy188III	TCNNGA	3 cut(s)	408, 750, 799
Hpy8I	GTNNAC	1 cut(s)	574
HpyAV	CCTTC	4 cut(s)	149, 194, 318, 896
HpyCH4IV	ACGT	1 cut(s)	292
HpyCH4V	TGCA	4 cut(s)	150, 479, 614, 894
HpyF3I	CTNAG	2 cut(s)	577, 600
HpySE526I	ACGT	1 cut(s)	292
Hsp92II	CATG	3 cut(s)	212, 614, 618
HspAI	GCGC	1 cut(s)	510
KflI	GGGWCCC	1 cut(s)	308
Kzo9I	GATC	1 cut(s)	203
LmnI	GCTCC	2 cut(s)	354, 461
LweI	GCATC	2 cut(s)	251, 385
MaeI	CTAG	1 cut(s)	714
MaeII	ACGT	1 cut(s)	292
MaeIII	GTNAC	2 cut(s)	75, 92
MalI	GATC	1 cut(s)	205
MboI	GATC	1 cut(s)	203
MboII	GAAGA	5 cut(s)	31, 504, 564, 775, 803
MhlI	GDGCHC	1 cut(s)	346
MluCI	AATT	8 cut(s)	254, 274, 461, 537, 723, 739, 818, 863
MlyI	GAGTC	3 cut(s)	405, 755, 801
MmeI	TCCRAC	3 cut(s)	44, 119, 832
Mph1103I	ATGCAT	2 cut(s)	616, 896
MseI	TTAA	6 cut(s)	55, 129, 235, 253, 273, 867
MslI	CAYNNNNRTG	1 cut(s)	211
MspA1I	CMGCKG	1 cut(s)	351
MspR9I	CCNGG	3 cut(s)	87, 382, 831
Mva1269I	GAATGC	1 cut(s)	782
MvaI	CCWGG	3 cut(s)	87, 382, 831
NdeII	GATC	1 cut(s)	203
NlaIII	CATG	3 cut(s)	212, 614, 618
NlaIV	GGNNCC	2 cut(s)	309, 310
NmuCI	GTSAC	2 cut(s)	75, 92
NsbI	TGCGCA	1 cut(s)	511
NsiI	ATGCAT	2 cut(s)	616, 896
NspI	RCATGY	2 cut(s)	212, 614
PciI	ACATGT	1 cut(s)	208
PctI	GAATGC	1 cut(s)	782
PfeI	GAWTC	1 cut(s)	593
PflMI	CCANNNNNTGG	1 cut(s)	851
PleI	GAGTC	3 cut(s)	405, 754, 800
PpsI	GAGTC	3 cut(s)	405, 754, 800
PpuMI	RGGWCCY	1 cut(s)	308
PscI	ACATGT	1 cut(s)	208
PshAI	GACNNNNGTC	1 cut(s)	415
PshBI	ATTAAT	1 cut(s)	55
PsiI	TTATAA	1 cut(s)	535
Psp5II	RGGWCCY	1 cut(s)	308
Psp6I	CCWGG	3 cut(s)	85, 380, 829
PspGI	CCWGG	3 cut(s)	85, 380, 829
PspN4I	GGNNCC	2 cut(s)	309, 310
PspPI	GGNCC	3 cut(s)	66, 308, 450
PspPPI	RGGWCCY	1 cut(s)	308
PvuII	CAGCTG	1 cut(s)	351
RsaI	GTAC	1 cut(s)	374
RsaNI	GTAC	1 cut(s)	373
RseI	CAYNNNNRTG	1 cut(s)	211
SaqAI	TTAA	6 cut(s)	55, 129, 235, 253, 273, 867
Sau3AI	GATC	1 cut(s)	203
Sau96I	GGNCC	3 cut(s)	66, 308, 450
SchI	GAGTC	3 cut(s)	405, 755, 801
ScrFI	CCNGG	3 cut(s)	87, 382, 831
SduI	GDGCHC	1 cut(s)	346
SfaNI	GCATC	2 cut(s)	251, 385
SinI	GGWCC	3 cut(s)	66, 308, 450
SmiMI	CAYNNNNRTG	1 cut(s)	211
SmlI	CTYRAG	2 cut(s)	26, 558
SmoI	CTYRAG	2 cut(s)	26, 558
Sse9I	AATT	8 cut(s)	254, 274, 461, 537, 723, 739, 818, 863
SspMI	CTAG	1 cut(s)	714
StyD4I	CCNGG	3 cut(s)	85, 380, 829
TaiI	ACGT	1 cut(s)	295
TasI	AATT	8 cut(s)	254, 274, 461, 537, 723, 739, 818, 863
TatI	WGTACW	1 cut(s)	372
TfiI	GAWTC	1 cut(s)	593
Tru1I	TTAA	6 cut(s)	55, 129, 235, 253, 273, 867
Tru9I	TTAA	6 cut(s)	55, 129, 235, 253, 273, 867
TscAI	CASTG	3 cut(s)	152, 287, 392
TseFI	GTSAC	2 cut(s)	75, 92
Tsp45I	GTSAC	2 cut(s)	75, 92
TspDTI	ATGAA	4 cut(s)	48, 127, 169, 425
TspRI	CASTG	3 cut(s)	152, 287, 392
Van91I	CCANNNNNTGG	1 cut(s)	851
VpaK11BI	GGWCC	3 cut(s)	66, 308, 450
VspI	ATTAAT	1 cut(s)	55
XagI	CCTNNNNNAGG	1 cut(s)	316
XapI	RAATTY	3 cut(s)	537, 723, 863
XceI	RCATGY	2 cut(s)	212, 614
XspI	CTAG	1 cut(s)	714
Zsp2I	ATGCAT	2 cut(s)	616, 896

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.