Rmu_sc0007404.1_g000016

VQ motif

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007404.1
OG0012167
Physical Location & Seq
Reverse (-)
63925 .. 64677
753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007404.1_g000016.1.cds

Sequence Viewer

Length: 753 bp
atggcggcgtcggataacctagcagcgatggagccgtgggcgtacaggccgacgacgacgtttgcggactcgtggatctcggaggcgtttgcgagggacacgaaggcgctgacgatggcgctgcagaagtcgctggcggacaacaggagctcggaatctccggattccgagttcttgccgttttttgatacgtttcaggcggaaacgacggctacgccgactgtttccggggtttcggggtcggatccggagtcggttgcggcgccgaagctgcggcagaggaacgcggttcccgtttcggggggcaaggtgacgaaacggaagtcgcgcgcgtcgaagcggacgcagacgactttcatcacggcggacccggcgaacttccggcagatggtgcagcaggtgacgggggtgaggtttaacggacagcagttctcttcgctgccgacggttgtcaagcccgagccgcagagacccggcggcaatcgcttaccgggcggcggatgcttgccgacgctcgacacgtcggcgttgttgttcgaccaccatcaacagcagcagcagaggcagaggcagcagtaccagcagcaggttgtggggcccgcatcggcaacgggaggaggtggacagatgggaccaatgcgctatggggcgacggtggaggtggctgagggtggtggtgccgtctctggcgggggattaggctttgactcttattcgagctttcccactttggagtcgtggaaggtcatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VQ

Protein Analysis

250

Amino Acids

26.76

Weight (kDa)

9.09

Isoelectric Point (pI)

49.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012167)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G41010 AT3G56880
fragaria_vesca FvH4_6g07790
malus_domestica MD04G1191900.v1.1
prunus_persica Prupe.6G310500_v2.0.a1
pyrus_communis pycom04g16940 pycom12g19130
rosa_chinensis RchiOBHm_Chr3g0457501
rosa_laevigata RLG00000025218
rosa_multiflora Rmu_co8346421.1_g000001 Rmu_sc0007404.1_g000016 Rmu_sc0038243.1_g000001
rosa_roxburghii Rroxscaffold_6G00421820
rosa_rugosa Rorug03G0020500
rosa_samantha Rh3AG081300 Rh3BG083400 Rh3CG083600 Rh3DG084800
rosa_wichuraiana Rw3G006970

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 388
Acc36I ACCTGC 2 cut(s) 388, 577
AccB1I GGYRCC 2 cut(s) 262, 677
AccII CGCG 4 cut(s) 287, 328, 330, 332
AccIII TCCGGA 2 cut(s) 160, 247
AclWI GGATC 3 cut(s) 83, 239, 252
AcyI GRCGYC 2 cut(s) 8, 263
AfaI GTAC 2 cut(s) 44, 578
AfiI CCNNNNNNNGG 5 cut(s) 299, 300, 388, 497, 586
AflIII ACRYGT 1 cut(s) 519
AjiI CACGTC 1 cut(s) 522
AloI GAACNNNNNNTCC 2 cut(s) 155, 187
AluBI AGCT 3 cut(s) 150, 271, 720
AluI AGCT 3 cut(s) 150, 271, 720
Alw21I GWGCWC 1 cut(s) 152
Alw26I GTCTC 2 cut(s) 463, 688
AlwI GGATC 3 cut(s) 83, 239, 252
Ama87I CYCGRG 1 cut(s) 458
Aor13HI TCCGGA 2 cut(s) 160, 247
AoxI GGCC 2 cut(s) 47, 596
ApaI GGGCCC 1 cut(s) 600
ApeKI GCWGC 9 cut(s) 23, 121, 271, 394, 439, 553, 556, 571, 583
ArsI GACNNNNNNTTYG 2 cut(s) 308, 340
AspLEI GCGC 6 cut(s) 109, 121, 265, 330, 332, 642
AspS9I GGNCC 4 cut(s) 367, 596, 597, 632
AsuC2I CCSGG 4 cut(s) 229, 371, 474, 492
AsuHPI GGTGA 3 cut(s) 322, 412, 421
AvaI CYCGRG 1 cut(s) 458
AvaII GGWCC 2 cut(s) 367, 632
BaeGI GKGCMC 1 cut(s) 600
BamHI GGATCC 1 cut(s) 244
BanI GGYRCC 2 cut(s) 262, 677
BanII GRGCYC 2 cut(s) 152, 600
BauI CACGAG 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 152
BbvCI CCTCAGC 1 cut(s) 666
BbvI GCAGC 9 cut(s) 35, 108, 258, 406, 426, 565, 568, 583, 595
BccI CCATC 5 cut(s) 22, 109, 382, 552, 622
BceAI ACGGC 5 cut(s) 19, 163, 225, 378, 665
BcgI CGANNNNNNTGC 2 cut(s) 103, 137
BcnI CCSGG 4 cut(s) 229, 371, 474, 492
BcoDI GTCTC 2 cut(s) 463, 688
BfaI CTAG 1 cut(s) 20
BfmI CTRYAG 1 cut(s) 122
BfoI RGCGCY 3 cut(s) 110, 122, 266
BfuAI ACCTGC 2 cut(s) 388, 577
Bme1390I CCNGG 4 cut(s) 229, 371, 474, 492
Bme18I GGWCC 2 cut(s) 367, 632
BmeT110I CYCGRG 1 cut(s) 458
BmgBI CACGTC 1 cut(s) 522
BmgT120I GGNCC 4 cut(s) 367, 596, 597, 632
BmiI GGNNCC 9 cut(s) 33, 246, 264, 291, 369, 597, 598, 633, 679
BmrFI CCNGG 4 cut(s) 229, 371, 474, 492
BmsI GCATC 2 cut(s) 491, 611
BoxI GACNNNNGTC 1 cut(s) 449
Bpu10I CCTNAGC 1 cut(s) 666
BpuMI CCSGG 4 cut(s) 229, 371, 474, 492
BsaHI GRCGYC 2 cut(s) 8, 263
BsaI GGTCTC 1 cut(s) 463
BsaJI CCNNGG 2 cut(s) 35, 228
BsaWI WCCGGW 2 cut(s) 160, 247
Bsc4I CCNNNNNNNGG 5 cut(s) 299, 300, 388, 497, 586
BseAI TCCGGA 2 cut(s) 160, 247
BseDI CCNNGG 2 cut(s) 35, 228
BseGI GGATG 1 cut(s) 506
BseLI CCNNNNNNNGG 5 cut(s) 299, 300, 388, 497, 586
BseMII CTCAG 1 cut(s) 657
BsePI GCGCGC 1 cut(s) 328
BseRI GAGGAG 1 cut(s) 630
BseSI GKGCMC 1 cut(s) 600
BseXI GCAGC 9 cut(s) 35, 108, 258, 406, 426, 565, 568, 583, 595
BsgI GTGCAG 1 cut(s) 413
Bsh1236I CGCG 4 cut(s) 287, 328, 330, 332
BshFI GGCC 2 cut(s) 49, 598
BshNI GGYRCC 2 cut(s) 262, 677
BsiHKAI GWGCWC 1 cut(s) 152
BsiHKCI CYCGRG 1 cut(s) 458
BsiSI CCGG 7 cut(s) 161, 228, 248, 371, 382, 474, 491
BslFI GGGAC 2 cut(s) 110, 645
BslI CCNNNNNNNGG 5 cut(s) 299, 300, 388, 497, 586
BsmAI GTCTC 2 cut(s) 463, 688
BsmBI CGTCTC 1 cut(s) 688
BsmFI GGGAC 2 cut(s) 110, 645
BsnI GGCC 2 cut(s) 49, 598
Bso31I GGTCTC 1 cut(s) 463
BsoBI CYCGRG 1 cut(s) 458
Bsp120I GGGCCC 1 cut(s) 596
Bsp1286I GDGCHC 2 cut(s) 152, 600
Bsp13I TCCGGA 2 cut(s) 160, 247
Bsp143I GATC 2 cut(s) 75, 244
BspANI GGCC 2 cut(s) 49, 598
BspCNI CTCAG 1 cut(s) 658
BspEI TCCGGA 2 cut(s) 160, 247
BspFNI CGCG 4 cut(s) 287, 328, 330, 332
BspLI GGNNCC 9 cut(s) 33, 246, 264, 291, 369, 597, 598, 633, 679
BspMAI CTGCAG 1 cut(s) 126
BspMI ACCTGC 2 cut(s) 388, 577
BspPI GGATC 3 cut(s) 83, 239, 252
BspT107I GGYRCC 2 cut(s) 262, 677
BspTNI GGTCTC 1 cut(s) 463
BssECI CCNNGG 2 cut(s) 35, 228
BssHII GCGCGC 1 cut(s) 328
BssMI GATC 2 cut(s) 75, 244
BssNI GRCGYC 2 cut(s) 8, 263
BssSI CACGAG 1 cut(s) 70
Bst2BI CACGAG 1 cut(s) 70
Bst4CI ACNGT 3 cut(s) 223, 448, 655
Bst6I CTCTTC 1 cut(s) 439
BstACI GRCGYC 2 cut(s) 8, 263
BstAPI GCANNNNNTGC 1 cut(s) 391
BstC8I GCNNGC 4 cut(s) 135, 330, 506, 600
BstDEI CTNAG 1 cut(s) 666
BstDSI CCRYGG 1 cut(s) 35
BstF5I GGATG 1 cut(s) 506
BstFNI CGCG 4 cut(s) 287, 328, 330, 332
BstH2I RGCGCY 3 cut(s) 110, 122, 266
BstHHI GCGC 6 cut(s) 109, 121, 265, 330, 332, 642
BstKTI GATC 2 cut(s) 78, 247
BstMAI GTCTC 2 cut(s) 463, 688
BstMBI GATC 2 cut(s) 75, 244
BstPAI GACNNNNGTC 1 cut(s) 449
BstSCI CCNGG 4 cut(s) 227, 369, 472, 490
BstSFI CTRYAG 1 cut(s) 122
BstSLI GKGCMC 1 cut(s) 600
BstUI CGCG 4 cut(s) 287, 328, 330, 332
BstV1I GCAGC 9 cut(s) 35, 108, 258, 406, 426, 565, 568, 583, 595
BstX2I RGATCY 2 cut(s) 75, 244
BstYI RGATCY 2 cut(s) 75, 244
BsuRI GGCC 2 cut(s) 49, 598
BtgI CCRYGG 1 cut(s) 35
BtgZI GCGATG 1 cut(s) 41
BtrI CACGTC 1 cut(s) 522
BtsCI GGATG 1 cut(s) 506
BveI ACCTGC 2 cut(s) 388, 577
Cac8I GCNNGC 4 cut(s) 135, 330, 506, 600
CfoI GCGC 6 cut(s) 109, 121, 265, 330, 332, 642
Cfr13I GGNCC 4 cut(s) 367, 596, 597, 632
CseI GACGC 3 cut(s) 321, 352, 520
Csp6I GTAC 2 cut(s) 43, 577
CviAII CATG 1 cut(s) 748
CviQI GTAC 2 cut(s) 43, 577
DdeI CTNAG 1 cut(s) 666
DinI GGCGCC 1 cut(s) 264
DpnI GATC 2 cut(s) 77, 246
DpnII GATC 2 cut(s) 75, 244
Eam1104I CTCTTC 1 cut(s) 439
EarI CTCTTC 1 cut(s) 439
EciI GGCGGA 4 cut(s) 152, 215, 380, 513
Ecl136II GAGCTC 1 cut(s) 150
Eco24I GRGCYC 2 cut(s) 152, 600
Eco31I GGTCTC 1 cut(s) 463
Eco47I GGWCC 2 cut(s) 367, 632
Eco53kI GAGCTC 1 cut(s) 150
Eco88I CYCGRG 1 cut(s) 458
EcoICRI GAGCTC 1 cut(s) 150
EcoO109I RGGNCCY 1 cut(s) 596
EcoT38I GRGCYC 2 cut(s) 152, 600
EgeI GGCGCC 1 cut(s) 264
EheI GGCGCC 1 cut(s) 264
Esp3I CGTCTC 1 cut(s) 688
FaeI CATG 1 cut(s) 751
FaiI YATR 2 cut(s) 645, 749
FaqI GGGAC 2 cut(s) 110, 645
FatI CATG 1 cut(s) 747
FauI CCCGC 2 cut(s) 607, 683
FokI GGATG 1 cut(s) 513
FriOI GRGCYC 2 cut(s) 152, 600
FspBI CTAG 1 cut(s) 20
GlaI GCGC 6 cut(s) 108, 120, 264, 329, 331, 641
HaeII RGCGCY 3 cut(s) 110, 122, 266
HaeIII GGCC 2 cut(s) 49, 598
HapII CCGG 7 cut(s) 161, 228, 248, 371, 382, 474, 491
HgaI GACGC 3 cut(s) 321, 352, 520
HhaI GCGC 6 cut(s) 109, 121, 265, 330, 332, 642
Hin1I GRCGYC 2 cut(s) 8, 263
Hin1II CATG 1 cut(s) 751
Hin6I GCGC 6 cut(s) 107, 119, 263, 328, 330, 640
HinP1I GCGC 6 cut(s) 107, 119, 263, 328, 330, 640
HinfI GANTC 6 cut(s) 68, 155, 164, 251, 707, 734
HpaII CCGG 7 cut(s) 161, 228, 248, 371, 382, 474, 491
HphI GGTGA 3 cut(s) 322, 412, 421
Hpy166II GTNNAC 1 cut(s) 623
Hpy188I TCNGA 5 cut(s) 13, 82, 154, 169, 244
Hpy188III TCNNGA 2 cut(s) 161, 248
Hpy8I GTNNAC 1 cut(s) 623
HpyAV CCTTC 2 cut(s) 97, 736
HpyCH4III ACNGT 3 cut(s) 223, 448, 655
HpyCH4IV ACGT 3 cut(s) 59, 191, 521
HpyCH4V TGCA 2 cut(s) 124, 394
HpyF3I CTNAG 1 cut(s) 666
HpySE526I ACGT 3 cut(s) 59, 191, 521
Hsp92I GRCGYC 2 cut(s) 8, 263
Hsp92II CATG 1 cut(s) 751
HspAI GCGC 6 cut(s) 107, 119, 263, 328, 330, 640
KasI GGCGCC 1 cut(s) 262
Kpn2I TCCGGA 2 cut(s) 160, 247
Kzo9I GATC 2 cut(s) 75, 244
LmnI GCTCC 2 cut(s) 31, 147
Lsp1109I GCAGC 9 cut(s) 35, 108, 258, 406, 426, 565, 568, 583, 595
LweI GCATC 2 cut(s) 491, 611
MaeI CTAG 1 cut(s) 20
MaeII ACGT 3 cut(s) 59, 191, 521
MaeIII GTNAC 2 cut(s) 310, 400
MalI GATC 2 cut(s) 77, 246
MauBI CGCGCGCG 1 cut(s) 328
MboI GATC 2 cut(s) 75, 244
MboII GAAGA 1 cut(s) 426
MflI RGATCY 2 cut(s) 75, 244
MhlI GDGCHC 2 cut(s) 152, 600
Mly113I GGCGCC 1 cut(s) 263
MlyI GAGTC 4 cut(s) 62, 260, 701, 743
MmeI TCCRAC 1 cut(s) 222
MroI TCCGGA 2 cut(s) 160, 247
MseI TTAA 1 cut(s) 417
MspI CCGG 7 cut(s) 161, 228, 248, 371, 382, 474, 491
MspR9I CCNGG 4 cut(s) 229, 371, 474, 492
MvnI CGCG 4 cut(s) 287, 328, 330, 332
NarI GGCGCC 1 cut(s) 263
NciI CCSGG 4 cut(s) 229, 371, 474, 492
NdeII GATC 2 cut(s) 75, 244
NlaIII CATG 1 cut(s) 751
NlaIV GGNNCC 9 cut(s) 33, 246, 264, 291, 369, 597, 598, 633, 679
NmuCI GTSAC 2 cut(s) 310, 400
PaqCI CACCTGC 1 cut(s) 388
PauI GCGCGC 1 cut(s) 328
PcsI WCGNNNNNNNCGW 4 cut(s) 215, 291, 332, 518
PfeI GAWTC 2 cut(s) 155, 164
PleI GAGTC 4 cut(s) 62, 259, 701, 742
PluTI GGCGCC 1 cut(s) 266
PpsI GAGTC 4 cut(s) 62, 259, 701, 742
PshAI GACNNNNGTC 1 cut(s) 449
Psp124BI GAGCTC 1 cut(s) 152
PspN4I GGNNCC 9 cut(s) 33, 246, 264, 291, 369, 597, 598, 633, 679
PspOMI GGGCCC 1 cut(s) 596
PspPI GGNCC 4 cut(s) 367, 596, 597, 632
PstI CTGCAG 1 cut(s) 126
PsuI RGATCY 2 cut(s) 75, 244
PteI GCGCGC 1 cut(s) 328
RsaI GTAC 2 cut(s) 44, 578
RsaNI GTAC 2 cut(s) 43, 577
SacI GAGCTC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 417
Sau3AI GATC 2 cut(s) 75, 244
Sau96I GGNCC 4 cut(s) 367, 596, 597, 632
SchI GAGTC 4 cut(s) 62, 260, 701, 743
ScrFI CCNGG 4 cut(s) 229, 371, 474, 492
SduI GDGCHC 2 cut(s) 152, 600
SfaNI GCATC 2 cut(s) 491, 611
SfcI CTRYAG 1 cut(s) 122
SfoI GGCGCC 1 cut(s) 264
SinI GGWCC 2 cut(s) 367, 632
SspDI GGCGCC 1 cut(s) 262
SspMI CTAG 1 cut(s) 20
SstI GAGCTC 1 cut(s) 152
StyD4I CCNGG 4 cut(s) 227, 369, 472, 490
TaaI ACNGT 3 cut(s) 223, 448, 655
TaiI ACGT 3 cut(s) 62, 194, 524
TaqI TCGA 4 cut(s) 335, 516, 537, 716
TauI GCSGC 6 cut(s) 8, 263, 277, 466, 480, 498
TfiI GAWTC 2 cut(s) 155, 164
Tru1I TTAA 1 cut(s) 417
Tru9I TTAA 1 cut(s) 417
TseFI GTSAC 2 cut(s) 310, 400
TseI GCWGC 9 cut(s) 23, 121, 271, 394, 439, 553, 556, 571, 583
Tsp45I GTSAC 2 cut(s) 310, 400
TspDTI ATGAA 1 cut(s) 346
TspGWI ACGGA 2 cut(s) 334, 435
VpaK11BI GGWCC 2 cut(s) 367, 632
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.