Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007728.1

Orthogroup ID

OG0008746

Physical Location & Seq

Genomic Coordinates Forward (+)

40702 .. 45139

Gene Structure 4438 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007728.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 966 bp

atgatgagtccaaggcaagtttctgaagatcgaggatctccgcaacatttcaggcacactcctttgcaagtaatccatattgttggaaatttcttgagaatatggtcaatttactccctgtaccgttacttgtctcagacgggggcttcggttgtactatttctcttcatttgtctgatcccagcatccatcctatttctaattttgcagaagccttggaagggcaggccactctcaaatacacaggtggttccttctattataaatggtggtataacagctctgtactttattttgtggggaaaaggcctcaaatcatgtggacctcttagagctataatggcagagtattctggtgctatccttggagtactctctgcagtattatatgggcggaaggataacgttgatactgaggttcagccagaacaggtgttaggtatgaaagagatggcaattccaatctttgcaggaatcttatcagcattgaggagggtgattgcaaggcgtgtttcattgaagaatcaacttaaaaggcgacttcatgctctaactattgcctctgcaacatgcttcatgtttcctattgccatgtgggacgtaatcataggatcagcttctagcagcagcaataagatgccattctctacttgggcttttctaagcaccattctttttggagttatcttgatattctatgttgatagtattgcggaagagagattacacatggttttctcttctccaaagcatttgatggtagctggaggatgcataatcgtgatggaaacggtgtacaaattggacttttctcttccaggattcctaatttgctgcatagttttgggctttgggatatacgaagcaacttctttggaacgtggtagaaaagattctttccaaaagcctgattcatcggatgggattttgggagatgaaattcagatgtctgcacttccaacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

321

Amino Acids

35.59

Weight (kDa)

9.33

Isoelectric Point (pI)

44.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008746)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G38380 AT5G38380
fragaria_vesca	FvH4_7g12860 FvH4_7g12860 FvH4_7g12860 FvH4_7g12860 FvH4_7g12860
malus_domestica	MD02G1195600.v1.1 MD07G1125200.v1.1
prunus_persica	Prupe.2G152900_v2.0.a1
pyrus_communis	pycom02g15950
rosa_chinensis	RchiOBHm_Chr1g0351931 RchiOBHm_Chr1g0351941
rosa_laevigata	RLG00000028373
rosa_multiflora	Rmu_sc0007728.1_g000008
rosa_roxburghii	Rroxscaffold_4G00303440
rosa_rugosa	Rorug01G0223000
rosa_samantha	Rh1AG236900 Rh1AG237000 Rh1BG207200 Rh1CG221400 Rh1DG234200
rosa_wichuraiana	Rw1G020610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	263
AciI	CCGC	3 cut(s)	41, 394, 713
AclI	AACGTT	1 cut(s)	405
AclWI	GGATC	3 cut(s)	43, 172, 619
AcsI	RAATTY	2 cut(s)	88, 939
AcuI	CTGAAG	1 cut(s)	45
AfaI	GTAC	5 cut(s)	122, 156, 287, 372, 797
AfiI	CCNNNNNNNGG	1 cut(s)	221
AgsI	TTSAA	1 cut(s)	520
AjnI	CCWGG	1 cut(s)	817
AjuI	GAANNNNNNNTTGG	1 cut(s)	36
AluBI	AGCT	4 cut(s)	281, 335, 617, 764
AluI	AGCT	4 cut(s)	281, 335, 617, 764
Alw26I	GTCTC	1 cut(s)	138
AlwI	GGATC	3 cut(s)	43, 172, 619
AoxI	GGCC	2 cut(s)	227, 307
ApeKI	GCWGC	3 cut(s)	624, 627, 834
ApoI	RAATTY	2 cut(s)	88, 939
ArsI	GACNNNNNNTTYG	2 cut(s)	130, 162
Asp700I	GAANNNNTTC	1 cut(s)	892
AspS9I	GGNCC	1 cut(s)	323
AsuHPI	GGTGA	1 cut(s)	508
AvaII	GGWCC	1 cut(s)	323
BaeI	ACNNNNGTAYC	2 cut(s)	402, 435
BarI	GAAGNNNNNNTAC	2 cut(s)	708, 740
BbvI	GCAGC	3 cut(s)	636, 639, 821
BccI	CCATC	5 cut(s)	197, 445, 751, 778, 914
BciT130I	CCWGG	1 cut(s)	819
BcoDI	GTCTC	1 cut(s)	138
BfaI	CTAG	1 cut(s)	621
BfmI	CTRYAG	1 cut(s)	378
BisI	GCNGC	3 cut(s)	625, 628, 835
BlsI	GCNGC	3 cut(s)	626, 629, 836
BmcAI	AGTACT	1 cut(s)	372
Bme1390I	CCNGG	1 cut(s)	819
Bme18I	GGWCC	1 cut(s)	323
BmgT120I	GGNCC	1 cut(s)	323
BmiI	GGNNCC	1 cut(s)	252
BmrFI	CCNGG	1 cut(s)	819
BmsI	GCATC	3 cut(s)	194, 627, 761
BpmI	CTGGAG	1 cut(s)	786
BpuEI	CTTGAG	1 cut(s)	115
BsaJI	CCNNGG	3 cut(s)	11, 215, 364
Bsc4I	CCNNNNNNNGG	1 cut(s)	221
BseBI	CCWGG	1 cut(s)	819
BseDI	CCNNGG	3 cut(s)	11, 215, 364
BseGI	GGATG	4 cut(s)	185, 189, 776, 925
BseLI	CCNNNNNNNGG	1 cut(s)	221
BseMII	CTCAG	2 cut(s)	149, 405
BseRI	GAGGAG	1 cut(s)	505
BseXI	GCAGC	3 cut(s)	636, 639, 821
BseYI	CCCAGC	1 cut(s)	181
BsgI	GTGCAG	1 cut(s)	936
BshFI	GGCC	2 cut(s)	229, 309
BslFI	GGGAC	1 cut(s)	611
BslI	CCNNNNNNNGG	1 cut(s)	221
BsmAI	GTCTC	1 cut(s)	138
BsmFI	GGGAC	1 cut(s)	611
BsnI	GGCC	2 cut(s)	229, 309
Bsp1407I	TGTACA	1 cut(s)	795
Bsp143I	GATC	4 cut(s)	28, 35, 177, 611
BspACI	CCGC	3 cut(s)	41, 394, 713
BspANI	GGCC	2 cut(s)	229, 309
BspCNI	CTCAG	2 cut(s)	148, 406
BspLI	GGNNCC	1 cut(s)	252
BspMAI	CTGCAG	1 cut(s)	382
BspPI	GGATC	3 cut(s)	43, 172, 619
BsrGI	TGTACA	1 cut(s)	795
BssECI	CCNNGG	3 cut(s)	11, 215, 364
BssMI	GATC	4 cut(s)	28, 35, 177, 611
BssT1I	CCWWGG	3 cut(s)	11, 215, 364
Bst2UI	CCWGG	1 cut(s)	819
Bst4CI	ACNGT	2 cut(s)	125, 793
Bst6I	CTCTTC	4 cut(s)	170, 711, 745, 819
BstAUI	TGTACA	1 cut(s)	795
BstC8I	GCNNGC	1 cut(s)	227
BstDEI	CTNAG	4 cut(s)	135, 329, 414, 662
BstF5I	GGATG	4 cut(s)	185, 189, 776, 925
BstKTI	GATC	4 cut(s)	31, 38, 180, 614
BstMAI	GTCTC	1 cut(s)	138
BstMBI	GATC	4 cut(s)	28, 35, 177, 611
BstMWI	GCNNNNNNNGC	1 cut(s)	341
BstNI	CCWGG	1 cut(s)	819
BstNSI	RCATGY	1 cut(s)	573
BstSCI	CCNGG	1 cut(s)	817
BstSFI	CTRYAG	1 cut(s)	378
BstV1I	GCAGC	3 cut(s)	636, 639, 821
BstX2I	RGATCY	1 cut(s)	35
BstXI	CCANNNNNNTGG	1 cut(s)	83
BstYI	RGATCY	1 cut(s)	35
BsuRI	GGCC	2 cut(s)	229, 309
BtsCI	GGATG	4 cut(s)	185, 189, 776, 925
Cac8I	GCNNGC	1 cut(s)	227
Cfr13I	GGNCC	1 cut(s)	323
Csp6I	GTAC	5 cut(s)	121, 155, 286, 371, 796
CspCI	CAANNNNNGTGG	2 cut(s)	301, 336
CviAII	CATG	6 cut(s)	318, 545, 570, 577, 592, 730
CviQI	GTAC	5 cut(s)	121, 155, 286, 371, 796
DdeI	CTNAG	4 cut(s)	135, 329, 414, 662
DpnI	GATC	4 cut(s)	30, 37, 179, 613
DpnII	GATC	4 cut(s)	28, 35, 177, 611
Eam1104I	CTCTTC	4 cut(s)	170, 711, 745, 819
EarI	CTCTTC	4 cut(s)	170, 711, 745, 819
EciI	GGCGGA	1 cut(s)	409
Eco130I	CCWWGG	3 cut(s)	11, 215, 364
Eco147I	AGGCCT	1 cut(s)	309
Eco47I	GGWCC	1 cut(s)	323
Eco57I	CTGAAG	1 cut(s)	45
EcoRII	CCWGG	1 cut(s)	817
EcoT14I	CCWWGG	3 cut(s)	11, 215, 364
EcoT22I	ATGCAT	1 cut(s)	776
ErhI	CCWWGG	3 cut(s)	11, 215, 364
FaeI	CATG	6 cut(s)	321, 548, 573, 580, 595, 733
FaqI	GGGAC	1 cut(s)	611
FatI	CATG	6 cut(s)	317, 544, 569, 576, 591, 729
Fnu4HI	GCNGC	3 cut(s)	625, 628, 835
FokI	GGATG	4 cut(s)	172, 176, 783, 932
Fsp4HI	GCNGC	3 cut(s)	625, 628, 835
FspBI	CTAG	1 cut(s)	621
GluI	GCNGC	3 cut(s)	625, 628, 835
GsaI	CCCAGC	1 cut(s)	185
GsuI	CTGGAG	1 cut(s)	786
HaeIII	GGCC	2 cut(s)	229, 309
Hin1II	CATG	6 cut(s)	321, 548, 573, 580, 595, 733
HinfI	GANTC	6 cut(s)	7, 474, 523, 822, 893, 911
HphI	GGTGA	1 cut(s)	508
Hpy166II	GTNNAC	2 cut(s)	323, 796
Hpy188I	TCNGA	5 cut(s)	25, 138, 177, 919, 945
Hpy188III	TCNNGA	3 cut(s)	94, 688, 781
Hpy8I	GTNNAC	2 cut(s)	323, 796
HpyAV	CCTTC	3 cut(s)	214, 264, 391
HpyCH4III	ACNGT	2 cut(s)	125, 793
HpyCH4IV	ACGT	3 cut(s)	405, 600, 880
HpyCH4V	TGCA	9 cut(s)	67, 208, 380, 470, 503, 566, 774, 837, 953
HpyF10VI	GCNNNNNNNGC	1 cut(s)	341
HpyF3I	CTNAG	4 cut(s)	135, 329, 414, 662
HpySE526I	ACGT	3 cut(s)	405, 600, 880
Hsp92II	CATG	6 cut(s)	321, 548, 573, 580, 595, 733
Kzo9I	GATC	4 cut(s)	28, 35, 177, 611
Lsp1109I	GCAGC	3 cut(s)	636, 639, 821
LweI	GCATC	3 cut(s)	194, 627, 761
MaeI	CTAG	1 cut(s)	621
MaeII	ACGT	3 cut(s)	405, 600, 880
MaeIII	GTNAC	1 cut(s)	125
MalI	GATC	4 cut(s)	30, 37, 179, 613
MboI	GATC	4 cut(s)	28, 35, 177, 611
MboII	GAAGA	6 cut(s)	38, 157, 532, 728, 732, 806
MflI	RGATCY	1 cut(s)	35
MluCI	AATT	7 cut(s)	88, 108, 201, 456, 800, 828, 939
MlyI	GAGTC	1 cut(s)	16
MmeI	TCCRAC	1 cut(s)	64
MnlI	CCTC	8 cut(s)	26, 320, 336, 409, 483, 486, 571, 761
Mph1103I	ATGCAT	1 cut(s)	776
MroXI	GAANNNNTTC	1 cut(s)	892
MseI	TTAA	1 cut(s)	531
MslI	CAYNNNNRTG	1 cut(s)	779
MspR9I	CCNGG	1 cut(s)	819
MvaI	CCWGG	1 cut(s)	819
MwoI	GCNNNNNNNGC	1 cut(s)	341
NdeII	GATC	4 cut(s)	28, 35, 177, 611
NlaIII	CATG	6 cut(s)	321, 548, 573, 580, 595, 733
NlaIV	GGNNCC	1 cut(s)	252
NsiI	ATGCAT	1 cut(s)	776
NspI	RCATGY	1 cut(s)	573
PceI	AGGCCT	1 cut(s)	309
PdmI	GAANNNNTTC	1 cut(s)	892
PfeI	GAWTC	5 cut(s)	474, 523, 822, 893, 911
PfoI	TCCNGGA	1 cut(s)	817
PkrI	GCNGC	3 cut(s)	626, 629, 836
PleI	GAGTC	1 cut(s)	15
PpsI	GAGTC	1 cut(s)	15
PsiI	TTATAA	1 cut(s)	263
Psp1406I	AACGTT	1 cut(s)	405
Psp6I	CCWGG	1 cut(s)	817
PspFI	CCCAGC	1 cut(s)	181
PspGI	CCWGG	1 cut(s)	817
PspN4I	GGNNCC	1 cut(s)	252
PspPI	GGNCC	1 cut(s)	323
PstI	CTGCAG	1 cut(s)	382
PsuI	RGATCY	1 cut(s)	35
RsaI	GTAC	5 cut(s)	122, 156, 287, 372, 797
RsaNI	GTAC	5 cut(s)	121, 155, 286, 371, 796
RseI	CAYNNNNRTG	1 cut(s)	779
SaqAI	TTAA	1 cut(s)	531
SatI	GCNGC	3 cut(s)	625, 628, 835
Sau3AI	GATC	4 cut(s)	28, 35, 177, 611
Sau96I	GGNCC	1 cut(s)	323
ScaI	AGTACT	1 cut(s)	372
SchI	GAGTC	1 cut(s)	16
ScrFI	CCNGG	1 cut(s)	819
SfaNI	GCATC	3 cut(s)	194, 627, 761
SfcI	CTRYAG	1 cut(s)	378
SinI	GGWCC	1 cut(s)	323
SmiMI	CAYNNNNRTG	1 cut(s)	779
SmlI	CTYRAG	1 cut(s)	94
SmoI	CTYRAG	1 cut(s)	94
Sse9I	AATT	7 cut(s)	88, 108, 201, 456, 800, 828, 939
SseBI	AGGCCT	1 cut(s)	309
SsiI	CCGC	3 cut(s)	41, 394, 713
SspMI	CTAG	1 cut(s)	621
StuI	AGGCCT	1 cut(s)	309
StyD4I	CCNGG	1 cut(s)	817
StyI	CCWWGG	3 cut(s)	11, 215, 364
TaaI	ACNGT	2 cut(s)	125, 793
TaiI	ACGT	3 cut(s)	408, 603, 883
TaqI	TCGA	1 cut(s)	31
TasI	AATT	7 cut(s)	88, 108, 201, 456, 800, 828, 939
TatI	WGTACW	4 cut(s)	154, 285, 370, 795
TfiI	GAWTC	5 cut(s)	474, 523, 822, 893, 911
Tru1I	TTAA	1 cut(s)	531
Tru9I	TTAA	1 cut(s)	531
TseI	GCWGC	3 cut(s)	624, 627, 834
TspDTI	ATGAA	7 cut(s)	157, 458, 504, 533, 565, 903, 951
VpaK11BI	GGWCC	1 cut(s)	323
XapI	RAATTY	2 cut(s)	88, 939
XceI	RCATGY	1 cut(s)	573
XcmI	CCANNNNNNNNNTGG	1 cut(s)	648
XmnI	GAANNNNTTC	1 cut(s)	892
XspI	CTAG	1 cut(s)	621
ZrmI	AGTACT	1 cut(s)	372
Zsp2I	ATGCAT	1 cut(s)	776

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.