Rmu_sc0007753.1_g000006

Small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007753.1
Physical Location & Seq
Forward (+)
18144 .. 18386
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007753.1_g000006.1.cds

Sequence Viewer

Length: 243 bp
atgagcaggtcaggccaacccccggatctgaagaagtacatggacaagaagcttcaaatcaagctaaatgcaaaccgaatgattgttggaaccttgcgtggatttgaccagttcatgaatctggtggttgataatactgtagaagtgaatggtgatgaaaagactaacataggcatggtggtgatcagaggaaacagtgtggttaatgttgaagcacttgaacctgtggccaaaatgcagtag

Protein Analysis

80

Amino Acids

8.94

Weight (kDa)

9.16

Isoelectric Point (pI)

34.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 33
AcoI YGGCCR 1 cut(s) 228
AcuI CTGAAG 1 cut(s) 50
AfaI GTAC 1 cut(s) 38
AfiI CCNNNNNNNGG 1 cut(s) 22
AgsI TTSAA 3 cut(s) 56, 212, 221
AluBI AGCT 2 cut(s) 52, 64
AluI AGCT 2 cut(s) 52, 64
AlwI GGATC 1 cut(s) 33
AoxI GGCC 2 cut(s) 13, 228
AsuC2I CCSGG 1 cut(s) 23
AsuHPI GGTGA 2 cut(s) 164, 193
BalI TGGCCA 1 cut(s) 230
BclI TGATCA 1 cut(s) 183
BcnI CCSGG 1 cut(s) 23
BfmI CTRYAG 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 23
BmiI GGNNCC 1 cut(s) 91
BmrFI CCNGG 1 cut(s) 23
BpuMI CCSGG 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 21
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse1I ACTGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 22
BseNI ACTGG 1 cut(s) 109
BshFI GGCC 2 cut(s) 15, 230
BsiSI CCGG 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 22
BsnI GGCC 2 cut(s) 15, 230
Bsp143I GATC 2 cut(s) 25, 183
BspANI GGCC 2 cut(s) 15, 230
BspHI TCATGA 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 91
BspPI GGATC 1 cut(s) 33
BsrI ACTGG 1 cut(s) 109
BssECI CCNNGG 1 cut(s) 21
BssMI GATC 2 cut(s) 25, 183
Bst4CI ACNGT 2 cut(s) 139, 197
BstKTI GATC 2 cut(s) 28, 186
BstMBI GATC 2 cut(s) 25, 183
BstMWI GCNNNNNNNGC 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 21
BstSFI CTRYAG 1 cut(s) 138
BstX2I RGATCY 1 cut(s) 25
BstYI RGATCY 1 cut(s) 25
BsuRI GGCC 2 cut(s) 15, 230
BtsIMutI CAGTG 1 cut(s) 202
CciI TCATGA 1 cut(s) 114
Csp6I GTAC 1 cut(s) 37
CviAII CATG 3 cut(s) 40, 115, 175
CviJI RGCY 4 cut(s) 15, 52, 64, 230
CviKI_1 RGCY 4 cut(s) 15, 52, 64, 230
CviQI GTAC 1 cut(s) 37
DpnI GATC 2 cut(s) 27, 185
DpnII GATC 2 cut(s) 25, 183
EaeI YGGCCR 1 cut(s) 228
Eco57I CTGAAG 1 cut(s) 50
FaeI CATG 3 cut(s) 43, 118, 178
FaiI YATR 4 cut(s) 41, 116, 170, 176
FatI CATG 3 cut(s) 39, 114, 174
FbaI TGATCA 1 cut(s) 183
HaeIII GGCC 2 cut(s) 15, 230
HapII CCGG 1 cut(s) 23
Hin1II CATG 3 cut(s) 43, 118, 178
HindIII AAGCTT 1 cut(s) 50
HinfI GANTC 1 cut(s) 118
HpaII CCGG 1 cut(s) 23
HphI GGTGA 2 cut(s) 164, 193
Hpy188I TCNGA 2 cut(s) 30, 188
Hpy188III TCNNGA 1 cut(s) 115
HpyCH4III ACNGT 2 cut(s) 139, 197
HpyCH4V TGCA 2 cut(s) 71, 238
HpyF10VI GCNNNNNNNGC 1 cut(s) 12
Hsp92II CATG 3 cut(s) 43, 118, 178
Ksp22I TGATCA 1 cut(s) 183
Kzo9I GATC 2 cut(s) 25, 183
LpnPI CCDG 4 cut(s) 36, 107, 122, 237
MalI GATC 2 cut(s) 27, 185
MboI GATC 2 cut(s) 25, 183
MboII GAAGA 1 cut(s) 43
MflI RGATCY 1 cut(s) 25
MlsI TGGCCA 1 cut(s) 230
MluNI TGGCCA 1 cut(s) 230
MmeI TCCRAC 1 cut(s) 67
MnlI CCTC 1 cut(s) 182
Mox20I TGGCCA 1 cut(s) 230
MscI TGGCCA 1 cut(s) 230
MseI TTAA 1 cut(s) 204
MslI CAYNNNNRTG 2 cut(s) 173, 179
Msp20I TGGCCA 1 cut(s) 230
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 12
NciI CCSGG 1 cut(s) 23
NdeII GATC 2 cut(s) 25, 183
NlaIII CATG 3 cut(s) 43, 118, 178
NlaIV GGNNCC 1 cut(s) 91
PagI TCATGA 1 cut(s) 114
PfeI GAWTC 1 cut(s) 118
PspN4I GGNNCC 1 cut(s) 91
PsuI RGATCY 1 cut(s) 25
RsaI GTAC 1 cut(s) 38
RsaNI GTAC 1 cut(s) 37
RseI CAYNNNNRTG 2 cut(s) 173, 179
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 2 cut(s) 25, 183
ScrFI CCNGG 1 cut(s) 23
SetI ASST 5 cut(s) 11, 54, 66, 95, 226
SfcI CTRYAG 1 cut(s) 138
SmiMI CAYNNNNRTG 2 cut(s) 173, 179
StyD4I CCNGG 1 cut(s) 21
TaaI ACNGT 2 cut(s) 139, 197
TatI WGTACW 1 cut(s) 36
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 1 cut(s) 202
TspDTI ATGAA 3 cut(s) 103, 131, 171
TspRI CASTG 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.