Rw3G018710

Small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
Physical Location & Seq
Reverse (-)
20976243 .. 20976446
204 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G018710.1

Sequence Viewer

Length: 204 bp
ATGGACAAGAAGCTTCAAATCAAGCTAAATGCAAACCGAATGATTGTTGGAACCTTGCGTGGATTTGACCAGTTCATGAATCTGGTGGTTGATAATACTGTAGAAGTGAATGGTGATGAAAAGACTAACATAGGCATGGTGGTGATCAGAGGAAACAGTGTGGTTAATGTTGAAGCACTTGAACCTGTGGCCAAAATGCAGTAG

Protein Analysis

67

Amino Acids

7.45

Weight (kDa)

6.13

Isoelectric Point (pI)

13.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LSM PF01423 1 - 57 2.2e-19 LSM domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 189
AgsI TTSAA 3 cut(s) 17, 173, 182
AluBI AGCT 2 cut(s) 13, 25
AluI AGCT 2 cut(s) 13, 25
AoxI GGCC 1 cut(s) 189
AsuHPI GGTGA 2 cut(s) 125, 154
BalI TGGCCA 1 cut(s) 191
BclI TGATCA 1 cut(s) 144
BfmI CTRYAG 1 cut(s) 99
BmiI GGNNCC 1 cut(s) 52
Bse1I ACTGG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 70
BshFI GGCC 1 cut(s) 191
BsnI GGCC 1 cut(s) 191
Bsp143I GATC 1 cut(s) 144
BspANI GGCC 1 cut(s) 191
BspHI TCATGA 1 cut(s) 75
BspLI GGNNCC 1 cut(s) 52
BsrI ACTGG 1 cut(s) 70
BssMI GATC 1 cut(s) 144
Bst4CI ACNGT 2 cut(s) 100, 158
BstKTI GATC 1 cut(s) 147
BstMBI GATC 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 99
BsuRI GGCC 1 cut(s) 191
BtsIMutI CAGTG 1 cut(s) 163
CciI TCATGA 1 cut(s) 75
CviAII CATG 2 cut(s) 76, 136
CviJI RGCY 3 cut(s) 13, 25, 191
CviKI_1 RGCY 3 cut(s) 13, 25, 191
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
EaeI YGGCCR 1 cut(s) 189
FaeI CATG 2 cut(s) 79, 139
FaiI YATR 3 cut(s) 77, 131, 137
FatI CATG 2 cut(s) 75, 135
FbaI TGATCA 1 cut(s) 144
HaeIII GGCC 1 cut(s) 191
Hin1II CATG 2 cut(s) 79, 139
HindIII AAGCTT 1 cut(s) 11
HinfI GANTC 1 cut(s) 79
HphI GGTGA 2 cut(s) 125, 154
Hpy188I TCNGA 1 cut(s) 149
Hpy188III TCNNGA 1 cut(s) 76
HpyCH4III ACNGT 2 cut(s) 100, 158
HpyCH4V TGCA 2 cut(s) 32, 199
Hsp92II CATG 2 cut(s) 79, 139
Ksp22I TGATCA 1 cut(s) 144
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 3 cut(s) 68, 83, 198
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MlsI TGGCCA 1 cut(s) 191
MluNI TGGCCA 1 cut(s) 191
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 1 cut(s) 143
Mox20I TGGCCA 1 cut(s) 191
MscI TGGCCA 1 cut(s) 191
MseI TTAA 1 cut(s) 165
MslI CAYNNNNRTG 2 cut(s) 134, 140
Msp20I TGGCCA 1 cut(s) 191
NdeII GATC 1 cut(s) 144
NlaIII CATG 2 cut(s) 79, 139
NlaIV GGNNCC 1 cut(s) 52
PagI TCATGA 1 cut(s) 75
PfeI GAWTC 1 cut(s) 79
PspN4I GGNNCC 1 cut(s) 52
RseI CAYNNNNRTG 2 cut(s) 134, 140
SaqAI TTAA 1 cut(s) 165
Sau3AI GATC 1 cut(s) 144
SetI ASST 4 cut(s) 15, 27, 56, 187
SfcI CTRYAG 1 cut(s) 99
SmiMI CAYNNNNRTG 2 cut(s) 134, 140
TaaI ACNGT 2 cut(s) 100, 158
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 1 cut(s) 165
Tru9I TTAA 1 cut(s) 165
TscAI CASTG 1 cut(s) 163
TspDTI ATGAA 3 cut(s) 64, 92, 132
TspRI CASTG 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.