Rmu_sc0008277.1_g000013

COBRA-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008277.1
OG0014650
Physical Location & Seq
Forward (+)
51795 .. 53790
1996 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008277.1_g000013.1.cds

Sequence Viewer

Length: 663 bp
atgaagggtgcctttgctaccaaacaaggaaactgctcatccttcaagtcagatataccacactcctgtgtgaaacatcccgaaatagttgatctcatgccagattcttccctagaaaacatgtcagtggactgctgccgtggtggcgttcttgatgcctgggctatcaacccctccaagtcattctcttcctttcaaattaaagtcggcaatttgcagcaaaattcttttggaactgcacctctcaaccttactttgatggcaccaggtcttggatacacttgcggaccgcttttggatgtcgatcctacagtttctttggatattgggggtagaagacaagttcaagttttcaatgaagttgccctcttttggggtataccctacgttaacaccgagctgatttccaccaagaaggaccaagtgggttcagtctcaactgaaatgcttttgaagaaggacatggactccttcacattctcaaatggatgggctttccctaggagactatatttcaatggagagagttgtcagatgcccctaccagacagtttcccaactttaccaaatggtgctgtctccaattttgcaaaaccctcacattgtcttttcctgcttttgacatttttgatttctcaggcactactagttccatgtctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
COBRA

Protein Analysis

220

Amino Acids

24.0

Weight (kDa)

5.88

Isoelectric Point (pI)

33.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 8, 262
AccB7I CCANNNNNTGG 1 cut(s) 272
AccI GTMKAC 1 cut(s) 379
AciI CCGC 2 cut(s) 285, 290
AclWI GGATC 1 cut(s) 299
AcsI RAATTY 1 cut(s) 223
AfiI CCNNNNNNNGG 3 cut(s) 272, 372, 373
AflIII ACRYGT 1 cut(s) 120
AgsI TTSAA 6 cut(s) 46, 197, 347, 355, 454, 517
AhlI ACTAGT 1 cut(s) 646
AjnI CCWGG 2 cut(s) 158, 265
AleI CACNNNNGTG 1 cut(s) 66
AluBI AGCT 1 cut(s) 400
AluI AGCT 1 cut(s) 400
Alw26I GTCTC 3 cut(s) 439, 499, 583
AlwI GGATC 1 cut(s) 299
ApeKI GCWGC 2 cut(s) 135, 217
ApoI RAATTY 1 cut(s) 223
AspA2I CCTAGG 1 cut(s) 500
AspS9I GGNCC 2 cut(s) 287, 418
AvaII GGWCC 2 cut(s) 287, 418
AvrII CCTAGG 1 cut(s) 500
BanI GGYRCC 2 cut(s) 8, 262
BbsI GAAGAC 1 cut(s) 343
BbvI GCAGC 2 cut(s) 122, 229
BccI CCATC 2 cut(s) 253, 483
BceAI ACGGC 1 cut(s) 123
BciT130I CCWGG 2 cut(s) 160, 267
BciVI GTATCC 1 cut(s) 269
BcoDI GTCTC 3 cut(s) 439, 499, 583
BcuI ACTAGT 1 cut(s) 646
BfaI CTAG 3 cut(s) 113, 501, 647
BfmI CTRYAG 1 cut(s) 309
BfuI GTATCC 1 cut(s) 269
BglI GCCNNNNNGGC 1 cut(s) 144
BisI GCNGC 2 cut(s) 136, 218
BlnI CCTAGG 1 cut(s) 500
BlsI GCNGC 2 cut(s) 137, 219
Bme1390I CCNGG 2 cut(s) 160, 267
Bme18I GGWCC 2 cut(s) 287, 418
BmgT120I GGNCC 2 cut(s) 287, 418
BmiI GGNNCC 2 cut(s) 10, 264
BmrFI CCNGG 2 cut(s) 160, 267
BmsI GCATC 2 cut(s) 145, 525
BpiI GAAGAC 1 cut(s) 343
BsaBI GATNNNNATC 1 cut(s) 303
BsaJI CCNNGG 3 cut(s) 139, 159, 500
BsaXI ACNNNNNCTCC 2 cut(s) 452, 482
Bsc4I CCNNNNNNNGG 3 cut(s) 272, 372, 373
Bse8I GATNNNNATC 1 cut(s) 303
BseBI CCWGG 2 cut(s) 160, 267
BseDI CCNNGG 3 cut(s) 139, 159, 500
BseGI GGATG 4 cut(s) 38, 76, 304, 494
BseJI GATNNNNATC 1 cut(s) 303
BseLI CCNNNNNNNGG 3 cut(s) 272, 372, 373
BseMII CTCAG 1 cut(s) 650
BseXI GCAGC 2 cut(s) 122, 229
BsgI GTGCAG 1 cut(s) 222
BshNI GGYRCC 2 cut(s) 8, 262
BslI CCNNNNNNNGG 3 cut(s) 272, 372, 373
BsmAI GTCTC 3 cut(s) 439, 499, 583
Bsp143I GATC 2 cut(s) 91, 304
BspACI CCGC 2 cut(s) 285, 290
BspCNI CTCAG 1 cut(s) 649
BspLI GGNNCC 2 cut(s) 10, 264
BspPI GGATC 1 cut(s) 299
BspT107I GGYRCC 2 cut(s) 8, 262
BssECI CCNNGG 3 cut(s) 139, 159, 500
BssMI GATC 2 cut(s) 91, 304
BssNAI GTATAC 1 cut(s) 380
BssT1I CCWWGG 1 cut(s) 500
Bst1107I GTATAC 1 cut(s) 380
Bst2UI CCWGG 2 cut(s) 160, 267
Bst4CI ACNGT 2 cut(s) 313, 551
Bst6I CTCTTC 1 cut(s) 193
BstDEI CTNAG 1 cut(s) 636
BstDSI CCRYGG 1 cut(s) 139
BstF5I GGATG 4 cut(s) 38, 76, 304, 494
BstKTI GATC 2 cut(s) 94, 307
BstMAI GTCTC 3 cut(s) 439, 499, 583
BstMBI GATC 2 cut(s) 91, 304
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNI CCWGG 2 cut(s) 160, 267
BstNSI RCATGY 1 cut(s) 124
BstSCI CCNGG 2 cut(s) 158, 265
BstSFI CTRYAG 1 cut(s) 309
BstV1I GCAGC 2 cut(s) 122, 229
BstV2I GAAGAC 1 cut(s) 343
BstZ17I GTATAC 1 cut(s) 380
BsuI GTATCC 1 cut(s) 269
BtgI CCRYGG 1 cut(s) 139
BtsCI GGATG 4 cut(s) 38, 76, 304, 494
BtsIMutI CAGTG 1 cut(s) 132
Cfr13I GGNCC 2 cut(s) 287, 418
CpoI CGGWCCG 1 cut(s) 287
CsiI ACCWGGT 1 cut(s) 265
CspI CGGWCCG 1 cut(s) 287
CviAII CATG 4 cut(s) 97, 121, 463, 654
CviJI RGCY 3 cut(s) 164, 400, 494
CviKI_1 RGCY 3 cut(s) 164, 400, 494
DdeI CTNAG 1 cut(s) 636
DpnI GATC 2 cut(s) 93, 306
DpnII GATC 2 cut(s) 91, 304
Eam1104I CTCTTC 1 cut(s) 193
EarI CTCTTC 1 cut(s) 193
Eco130I CCWWGG 1 cut(s) 500
Eco47I GGWCC 2 cut(s) 287, 418
EcoRII CCWGG 2 cut(s) 158, 265
EcoT14I CCWWGG 1 cut(s) 500
ErhI CCWWGG 1 cut(s) 500
FaeI CATG 4 cut(s) 100, 124, 466, 657
FaiI YATR 7 cut(s) 56, 98, 122, 380, 464, 511, 655
FalI AAGNNNNNCTT 1 cut(s) 28
FatI CATG 4 cut(s) 96, 120, 462, 653
FblI GTMKAC 1 cut(s) 379
Fnu4HI GCNGC 2 cut(s) 136, 218
FokI GGATG 4 cut(s) 25, 63, 311, 501
Fsp4HI GCNGC 2 cut(s) 136, 218
FspBI CTAG 3 cut(s) 113, 501, 647
GluI GCNGC 2 cut(s) 136, 218
Hin1II CATG 4 cut(s) 100, 124, 466, 657
HincII GTYRAC 1 cut(s) 391
HindII GTYRAC 1 cut(s) 391
HinfI GANTC 2 cut(s) 104, 467
HpaI GTTAAC 1 cut(s) 391
Hpy166II GTNNAC 3 cut(s) 130, 380, 391
Hpy188I TCNGA 2 cut(s) 52, 534
Hpy188III TCNNGA 2 cut(s) 80, 152
Hpy8I GTNNAC 3 cut(s) 130, 380, 391
HpyAV CCTTC 4 cut(s) 52, 409, 451, 481
HpyCH4III ACNGT 2 cut(s) 313, 551
HpyCH4IV ACGT 1 cut(s) 387
HpyCH4V TGCA 3 cut(s) 217, 239, 590
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 636
HpySE526I ACGT 1 cut(s) 387
Hsp92II CATG 4 cut(s) 100, 124, 466, 657
KspAI GTTAAC 1 cut(s) 391
Kzo9I GATC 2 cut(s) 91, 304
LpnPI CCDG 9 cut(s) 79, 114, 145, 172, 252, 279, 558, 623, 626
Lsp1109I GCAGC 2 cut(s) 122, 229
LweI GCATC 2 cut(s) 145, 525
MabI ACCWGGT 1 cut(s) 265
MaeI CTAG 3 cut(s) 113, 501, 647
MaeII ACGT 1 cut(s) 387
MalI GATC 2 cut(s) 93, 306
MboI GATC 2 cut(s) 91, 304
MboII GAAGA 4 cut(s) 99, 180, 348, 466
MluCI AATT 4 cut(s) 198, 211, 223, 583
MlyI GAGTC 1 cut(s) 461
MnlI CCTC 4 cut(s) 184, 252, 377, 607
MseI TTAA 2 cut(s) 201, 390
MslI CAYNNNNRTG 2 cut(s) 66, 125
MspR9I CCNGG 2 cut(s) 160, 267
MvaI CCWGG 2 cut(s) 160, 267
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeII GATC 2 cut(s) 91, 304
NlaIII CATG 4 cut(s) 100, 124, 466, 657
NlaIV GGNNCC 2 cut(s) 10, 264
NspI RCATGY 1 cut(s) 124
OliI CACNNNNGTG 1 cut(s) 66
PciI ACATGT 1 cut(s) 120
PcsI WCGNNNNNNNCGW 1 cut(s) 393
PfeI GAWTC 1 cut(s) 104
PflMI CCANNNNNTGG 1 cut(s) 272
PkrI GCNGC 2 cut(s) 137, 219
PleI GAGTC 1 cut(s) 461
PpsI GAGTC 1 cut(s) 461
PscI ACATGT 1 cut(s) 120
Psp6I CCWGG 2 cut(s) 158, 265
PspGI CCWGG 2 cut(s) 158, 265
PspN4I GGNNCC 2 cut(s) 10, 264
PspPI GGNCC 2 cut(s) 287, 418
RseI CAYNNNNRTG 2 cut(s) 66, 125
Rsr2I CGGWCCG 1 cut(s) 287
RsrII CGGWCCG 1 cut(s) 287
SaqAI TTAA 2 cut(s) 201, 390
SatI GCNGC 2 cut(s) 136, 218
Sau3AI GATC 2 cut(s) 91, 304
Sau96I GGNCC 2 cut(s) 287, 418
SchI GAGTC 1 cut(s) 461
ScrFI CCNGG 2 cut(s) 160, 267
SetI ASST 5 cut(s) 244, 252, 271, 390, 402
SexAI ACCWGGT 1 cut(s) 265
SfaNI GCATC 2 cut(s) 145, 525
SfcI CTRYAG 1 cut(s) 309
SinI GGWCC 2 cut(s) 287, 418
SmiMI CAYNNNNRTG 2 cut(s) 66, 125
SpeI ACTAGT 1 cut(s) 646
Sse9I AATT 4 cut(s) 198, 211, 223, 583
SsiI CCGC 2 cut(s) 285, 290
SspMI CTAG 3 cut(s) 113, 501, 647
StyD4I CCNGG 2 cut(s) 158, 265
StyI CCWWGG 1 cut(s) 500
TaaI ACNGT 2 cut(s) 313, 551
TaiI ACGT 1 cut(s) 390
TaqI TCGA 1 cut(s) 303
TasI AATT 4 cut(s) 198, 211, 223, 583
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 2 cut(s) 201, 390
Tru9I TTAA 2 cut(s) 201, 390
TscAI CASTG 1 cut(s) 132
TseI GCWGC 2 cut(s) 135, 217
TspDTI ATGAA 2 cut(s) 17, 372
TspRI CASTG 1 cut(s) 132
Van91I CCANNNNNTGG 1 cut(s) 272
VpaK11BI GGWCC 2 cut(s) 287, 418
XapI RAATTY 1 cut(s) 223
XceI RCATGY 1 cut(s) 124
XmaJI CCTAGG 1 cut(s) 500
XmiI GTMKAC 1 cut(s) 379
XspI CTAG 3 cut(s) 113, 501, 647
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.