Rmu_sc0040933.1_g000001

COBRA-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040933.1
OG0014650
Physical Location & Seq
Reverse (-)
30 .. 392
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040933.1_g000001.1.cds

Sequence Viewer

Length: 363 bp
atgaagggtgcctttgctaccaaacaaggaaactgctcatccttcaagtcagatataccacactcctgtgtgaaacatcccgaaatagttgatctcatgccagattcttccctagaaaacatgtcagtggactgctgccgtggtggcgttcttgatgcctgggctatcaacccctccaagtcattctcttcctttcagattaaagtcggcaatttgcagcaaaattcttttggaactgcacctctcaaccttactttgatggcaccaggtcttggatacacttgcggaccgcttttggatgtcgatcctacagtttctttggatattgggggtagaagacaagttcaagttttcagtaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
COBRA

Protein Analysis

120

Amino Acids

12.82

Weight (kDa)

6.69

Isoelectric Point (pI)

31.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 8, 262
AccB7I CCANNNNNTGG 1 cut(s) 272
AciI CCGC 2 cut(s) 285, 290
AclWI GGATC 1 cut(s) 299
AcsI RAATTY 1 cut(s) 223
AfiI CCNNNNNNNGG 1 cut(s) 272
AflIII ACRYGT 1 cut(s) 120
AgsI TTSAA 2 cut(s) 46, 347
AjnI CCWGG 2 cut(s) 158, 265
AleI CACNNNNGTG 1 cut(s) 66
AlwI GGATC 1 cut(s) 299
ApeKI GCWGC 2 cut(s) 135, 217
ApoI RAATTY 1 cut(s) 223
AspS9I GGNCC 1 cut(s) 287
AvaII GGWCC 1 cut(s) 287
BanI GGYRCC 2 cut(s) 8, 262
BbsI GAAGAC 1 cut(s) 343
BbvI GCAGC 2 cut(s) 122, 229
BccI CCATC 1 cut(s) 253
BceAI ACGGC 1 cut(s) 123
BciT130I CCWGG 2 cut(s) 160, 267
BciVI GTATCC 1 cut(s) 269
BfaI CTAG 1 cut(s) 113
BfmI CTRYAG 1 cut(s) 309
BfuI GTATCC 1 cut(s) 269
BglI GCCNNNNNGGC 1 cut(s) 144
BisI GCNGC 2 cut(s) 136, 218
BlsI GCNGC 2 cut(s) 137, 219
Bme1390I CCNGG 2 cut(s) 160, 267
Bme18I GGWCC 1 cut(s) 287
BmgT120I GGNCC 1 cut(s) 287
BmiI GGNNCC 2 cut(s) 10, 264
BmrFI CCNGG 2 cut(s) 160, 267
BmsI GCATC 1 cut(s) 145
BpiI GAAGAC 1 cut(s) 343
BsaBI GATNNNNATC 1 cut(s) 303
BsaJI CCNNGG 2 cut(s) 139, 159
Bsc4I CCNNNNNNNGG 1 cut(s) 272
Bse8I GATNNNNATC 1 cut(s) 303
BseBI CCWGG 2 cut(s) 160, 267
BseDI CCNNGG 2 cut(s) 139, 159
BseGI GGATG 3 cut(s) 38, 76, 304
BseJI GATNNNNATC 1 cut(s) 303
BseLI CCNNNNNNNGG 1 cut(s) 272
BseXI GCAGC 2 cut(s) 122, 229
BsgI GTGCAG 1 cut(s) 222
BshNI GGYRCC 2 cut(s) 8, 262
BslI CCNNNNNNNGG 1 cut(s) 272
Bsp143I GATC 2 cut(s) 91, 304
BspACI CCGC 2 cut(s) 285, 290
BspLI GGNNCC 2 cut(s) 10, 264
BspPI GGATC 1 cut(s) 299
BspT107I GGYRCC 2 cut(s) 8, 262
BssECI CCNNGG 2 cut(s) 139, 159
BssMI GATC 2 cut(s) 91, 304
Bst2UI CCWGG 2 cut(s) 160, 267
Bst4CI ACNGT 1 cut(s) 313
Bst6I CTCTTC 1 cut(s) 193
BstDSI CCRYGG 1 cut(s) 139
BstF5I GGATG 3 cut(s) 38, 76, 304
BstKTI GATC 2 cut(s) 94, 307
BstMBI GATC 2 cut(s) 91, 304
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNI CCWGG 2 cut(s) 160, 267
BstNSI RCATGY 1 cut(s) 124
BstSCI CCNGG 2 cut(s) 158, 265
BstSFI CTRYAG 1 cut(s) 309
BstV1I GCAGC 2 cut(s) 122, 229
BstV2I GAAGAC 1 cut(s) 343
BsuI GTATCC 1 cut(s) 269
BtgI CCRYGG 1 cut(s) 139
BtsCI GGATG 3 cut(s) 38, 76, 304
BtsIMutI CAGTG 1 cut(s) 132
Cfr13I GGNCC 1 cut(s) 287
CpoI CGGWCCG 1 cut(s) 287
CsiI ACCWGGT 1 cut(s) 265
CspI CGGWCCG 1 cut(s) 287
CviAII CATG 2 cut(s) 97, 121
CviJI RGCY 1 cut(s) 164
CviKI_1 RGCY 1 cut(s) 164
DpnI GATC 2 cut(s) 93, 306
DpnII GATC 2 cut(s) 91, 304
Eam1104I CTCTTC 1 cut(s) 193
EarI CTCTTC 1 cut(s) 193
Eco47I GGWCC 1 cut(s) 287
EcoRII CCWGG 2 cut(s) 158, 265
FaeI CATG 2 cut(s) 100, 124
FaiI YATR 3 cut(s) 56, 98, 122
FalI AAGNNNNNCTT 1 cut(s) 28
FatI CATG 2 cut(s) 96, 120
Fnu4HI GCNGC 2 cut(s) 136, 218
FokI GGATG 3 cut(s) 25, 63, 311
Fsp4HI GCNGC 2 cut(s) 136, 218
FspBI CTAG 1 cut(s) 113
GluI GCNGC 2 cut(s) 136, 218
Hin1II CATG 2 cut(s) 100, 124
HinfI GANTC 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 2 cut(s) 52, 198
Hpy188III TCNNGA 2 cut(s) 80, 152
Hpy8I GTNNAC 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 52
HpyCH4III ACNGT 1 cut(s) 313
HpyCH4V TGCA 2 cut(s) 217, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
Hsp92II CATG 2 cut(s) 100, 124
Kzo9I GATC 2 cut(s) 91, 304
LpnPI CCDG 6 cut(s) 79, 114, 145, 172, 252, 279
Lsp1109I GCAGC 2 cut(s) 122, 229
LweI GCATC 1 cut(s) 145
MabI ACCWGGT 1 cut(s) 265
MaeI CTAG 1 cut(s) 113
MalI GATC 2 cut(s) 93, 306
MboI GATC 2 cut(s) 91, 304
MboII GAAGA 3 cut(s) 99, 180, 348
MluCI AATT 2 cut(s) 211, 223
MnlI CCTC 2 cut(s) 184, 252
MseI TTAA 1 cut(s) 201
MslI CAYNNNNRTG 2 cut(s) 66, 125
MspR9I CCNGG 2 cut(s) 160, 267
MvaI CCWGG 2 cut(s) 160, 267
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeII GATC 2 cut(s) 91, 304
NlaIII CATG 2 cut(s) 100, 124
NlaIV GGNNCC 2 cut(s) 10, 264
NspI RCATGY 1 cut(s) 124
OliI CACNNNNGTG 1 cut(s) 66
PciI ACATGT 1 cut(s) 120
PfeI GAWTC 1 cut(s) 104
PflMI CCANNNNNTGG 1 cut(s) 272
PkrI GCNGC 2 cut(s) 137, 219
PscI ACATGT 1 cut(s) 120
Psp6I CCWGG 2 cut(s) 158, 265
PspGI CCWGG 2 cut(s) 158, 265
PspN4I GGNNCC 2 cut(s) 10, 264
PspPI GGNCC 1 cut(s) 287
RseI CAYNNNNRTG 2 cut(s) 66, 125
Rsr2I CGGWCCG 1 cut(s) 287
RsrII CGGWCCG 1 cut(s) 287
SaqAI TTAA 1 cut(s) 201
SatI GCNGC 2 cut(s) 136, 218
Sau3AI GATC 2 cut(s) 91, 304
Sau96I GGNCC 1 cut(s) 287
ScrFI CCNGG 2 cut(s) 160, 267
SetI ASST 3 cut(s) 244, 252, 271
SexAI ACCWGGT 1 cut(s) 265
SfaNI GCATC 1 cut(s) 145
SfcI CTRYAG 1 cut(s) 309
SinI GGWCC 1 cut(s) 287
SmiMI CAYNNNNRTG 2 cut(s) 66, 125
Sse9I AATT 2 cut(s) 211, 223
SsiI CCGC 2 cut(s) 285, 290
SspMI CTAG 1 cut(s) 113
StyD4I CCNGG 2 cut(s) 158, 265
TaaI ACNGT 1 cut(s) 313
TaqI TCGA 1 cut(s) 303
TasI AATT 2 cut(s) 211, 223
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TscAI CASTG 1 cut(s) 132
TseI GCWGC 2 cut(s) 135, 217
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 132
Van91I CCANNNNNTGG 1 cut(s) 272
VpaK11BI GGWCC 1 cut(s) 287
XapI RAATTY 1 cut(s) 223
XceI RCATGY 1 cut(s) 124
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.