Rmu_sc0008829.1_g000001

Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008829.1
Physical Location & Seq
Forward (+)
1 .. 1344
1344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008829.1_g000001.1.cds

Sequence Viewer

Length: 431 bp
gttcccacaacatcggaattgccatggatactccatatggtctagttgtgccaaacataaagaatgttcagtctctttccatattggagataacaaaggaactttcacggttactacaattggcattggaaaacaagcttaggcctgaagatatatctggaggaacaattactctaagtaatattggggctattggtgggaagtatggttcccctcttctcaacttgccagaggttgccattattgcaattggacgaattcagaaggttccacaatatgcagatgatggaagtgtatatcctgcatcagttatgacggttaatataggcgctgatcatagagtgctggacggagcaactgttgcccgattctgtaaagagtggaaacaattaatagagaatccagagctgctcatgttgcacatgacatag

Protein Analysis

142

Amino Acids

15.39

Weight (kDa)

5.87

Isoelectric Point (pI)

50.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 257
AcuI CTGAAG 1 cut(s) 167
AloI GAACNNNNNNTCC 2 cut(s) 192, 224
AluBI AGCT 2 cut(s) 138, 408
AluI AGCT 2 cut(s) 138, 408
Alw26I GTCTC 1 cut(s) 77
AoxI GGCC 1 cut(s) 142
ApeKI GCWGC 1 cut(s) 408
ApoI RAATTY 1 cut(s) 257
AseI ATTAAT 1 cut(s) 391
AspLEI GCGC 1 cut(s) 331
BbvI GCAGC 1 cut(s) 395
BccI CCATC 1 cut(s) 280
BciVI GTATCC 1 cut(s) 21
BclI TGATCA 1 cut(s) 333
BcoDI GTCTC 1 cut(s) 77
BfaI CTAG 1 cut(s) 43
BfoI RGCGCY 1 cut(s) 332
BfuI GTATCC 1 cut(s) 21
BisI GCNGC 1 cut(s) 409
BlsI GCNGC 1 cut(s) 410
BmiI GGNNCC 2 cut(s) 210, 269
BmsI GCATC 1 cut(s) 313
BpmI CTGGAG 1 cut(s) 179
Bpu10I CCTNAGC 1 cut(s) 139
BsaJI CCNNGG 1 cut(s) 23
BsaXI ACNNNNNCTCC 2 cut(s) 344, 374
BseDI CCNNGG 1 cut(s) 23
BseXI GCAGC 1 cut(s) 395
BshFI GGCC 1 cut(s) 144
BsmAI GTCTC 1 cut(s) 77
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 333
Bsp19I CCATGG 1 cut(s) 23
BspANI GGCC 1 cut(s) 144
BspLI GGNNCC 2 cut(s) 210, 269
BssECI CCNNGG 1 cut(s) 23
BssMI GATC 1 cut(s) 333
BssT1I CCWWGG 1 cut(s) 23
Bst4CI ACNGT 3 cut(s) 110, 318, 360
Bst6I CTCTTC 1 cut(s) 221
BstAPI GCANNNNNTGC 1 cut(s) 361
BstDEI CTNAG 2 cut(s) 139, 175
BstDSI CCRYGG 1 cut(s) 23
BstH2I RGCGCY 1 cut(s) 332
BstHHI GCGC 1 cut(s) 331
BstKTI GATC 1 cut(s) 336
BstMAI GTCTC 1 cut(s) 77
BstMBI GATC 1 cut(s) 333
BstMWI GCNNNNNNNGC 3 cut(s) 244, 361, 417
BstV1I GCAGC 1 cut(s) 395
BsuI GTATCC 1 cut(s) 21
BsuRI GGCC 1 cut(s) 144
BtgI CCRYGG 1 cut(s) 23
CfoI GCGC 1 cut(s) 331
CviAII CATG 3 cut(s) 24, 414, 423
CviJI RGCY 4 cut(s) 138, 144, 190, 408
CviKI_1 RGCY 4 cut(s) 138, 144, 190, 408
DdeI CTNAG 2 cut(s) 139, 175
DpnI GATC 1 cut(s) 335
DpnII GATC 1 cut(s) 333
Eam1104I CTCTTC 1 cut(s) 221
EarI CTCTTC 1 cut(s) 221
Eco130I CCWWGG 1 cut(s) 23
Eco147I AGGCCT 1 cut(s) 144
Eco57I CTGAAG 1 cut(s) 167
EcoRI GAATTC 1 cut(s) 257
EcoT14I CCWWGG 1 cut(s) 23
ErhI CCWWGG 1 cut(s) 23
FaeI CATG 3 cut(s) 27, 417, 426
FatI CATG 3 cut(s) 23, 413, 422
FauNDI CATATG 1 cut(s) 36
FbaI TGATCA 1 cut(s) 333
Fnu4HI GCNGC 1 cut(s) 409
Fsp4HI GCNGC 1 cut(s) 409
FspBI CTAG 1 cut(s) 43
GlaI GCGC 1 cut(s) 330
GluI GCNGC 1 cut(s) 409
GsuI CTGGAG 1 cut(s) 179
HaeII RGCGCY 1 cut(s) 332
HaeIII GGCC 1 cut(s) 144
HhaI GCGC 1 cut(s) 331
Hin1II CATG 3 cut(s) 27, 417, 426
Hin6I GCGC 1 cut(s) 329
HinP1I GCGC 1 cut(s) 329
HindIII AAGCTT 1 cut(s) 136
HinfI GANTC 2 cut(s) 368, 399
Hpy188I TCNGA 2 cut(s) 16, 263
Hpy188III TCNNGA 2 cut(s) 158, 403
HpyAV CCTTC 1 cut(s) 258
HpyCH4III ACNGT 3 cut(s) 110, 318, 360
HpyCH4V TGCA 4 cut(s) 247, 280, 304, 420
HpyF10VI GCNNNNNNNGC 3 cut(s) 244, 361, 417
HpyF3I CTNAG 2 cut(s) 139, 175
Hsp92II CATG 3 cut(s) 27, 417, 426
HspAI GCGC 1 cut(s) 329
Ksp22I TGATCA 1 cut(s) 333
Kzo9I GATC 1 cut(s) 333
LmnI GCTCC 1 cut(s) 352
LpnPI CCDG 6 cut(s) 143, 158, 242, 314, 331, 416
Lsp1109I GCAGC 1 cut(s) 395
LweI GCATC 1 cut(s) 313
MaeI CTAG 1 cut(s) 43
MaeIII GTNAC 1 cut(s) 110
MalI GATC 1 cut(s) 335
MboI GATC 1 cut(s) 333
MboII GAAGA 2 cut(s) 160, 208
MfeI CAATTG 2 cut(s) 118, 248
MluCI AATT 6 cut(s) 17, 118, 167, 248, 257, 388
MnlI CCTC 3 cut(s) 154, 224, 225
MseI TTAA 2 cut(s) 320, 391
MunI CAATTG 2 cut(s) 118, 248
MwoI GCNNNNNNNGC 3 cut(s) 244, 361, 417
NcoI CCATGG 1 cut(s) 23
NdeI CATATG 1 cut(s) 36
NdeII GATC 1 cut(s) 333
NlaIII CATG 3 cut(s) 27, 417, 426
NlaIV GGNNCC 2 cut(s) 210, 269
PceI AGGCCT 1 cut(s) 144
PfeI GAWTC 2 cut(s) 368, 399
PkrI GCNGC 1 cut(s) 410
PshBI ATTAAT 1 cut(s) 391
PspN4I GGNNCC 2 cut(s) 210, 269
SaqAI TTAA 2 cut(s) 320, 391
SatI GCNGC 1 cut(s) 409
Sau3AI GATC 1 cut(s) 333
SetI ASST 4 cut(s) 140, 236, 269, 410
SfaNI GCATC 1 cut(s) 313
Sse9I AATT 6 cut(s) 17, 118, 167, 248, 257, 388
SseBI AGGCCT 1 cut(s) 144
SspI AATATT 1 cut(s) 183
SspMI CTAG 1 cut(s) 43
StuI AGGCCT 1 cut(s) 144
StyI CCWWGG 1 cut(s) 23
TaaI ACNGT 3 cut(s) 110, 318, 360
TasI AATT 6 cut(s) 17, 118, 167, 248, 257, 388
TfiI GAWTC 2 cut(s) 368, 399
Tru1I TTAA 2 cut(s) 320, 391
Tru9I TTAA 2 cut(s) 320, 391
TseI GCWGC 1 cut(s) 408
TspGWI ACGGA 1 cut(s) 365
VspI ATTAAT 1 cut(s) 391
XapI RAATTY 1 cut(s) 257
XspI CTAG 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.