Rmu_sc0008852.1_g000003

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008852.1
Physical Location & Seq
Forward (+)
14321 .. 15225
905 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008852.1_g000003.1.cds

Sequence Viewer

Length: 576 bp
atggctctgtggaacagcatcaccatcatcttctttgcaaaggaaggcgaggactgtaacctgacaccaacgaagtttaacctcctcccacctgtgacagtacactttcaacaaggcctgggccagaagttcaaacaaccccctggaactggaattaacttctcaatgtttgacgagacagagttactgaaagtagctggcttggatatctatcctctagcagtgaaggcagaggcatccccacctgagcatgatggatcagagggaaactctgtatctgtagcaacgaactcccagataactcaggctgtatttgagagggagaaaggtgaattccaggtgagggttgtcaagcagatcctttgggtgagtgggatgaggtatgaactacaggagatatatggaattggtaattcagtcgaggatgacttggacgggaacgatccaggaaaagaatgcgtcatttgcctgtctgaaccacgggacacaactgttcttccatgtcggcacatgtgtatgtgcagcgggtgtgccaaggttttgagataccagacaaaccgatgtccaatttgctga

Protein Analysis

191

Amino Acids

21.18

Weight (kDa)

4.99

Isoelectric Point (pI)

32.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011828)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 525
AclWI GGATC 3 cut(s) 265, 352, 437
AcsI RAATTY 1 cut(s) 332
AfaI GTAC 1 cut(s) 102
AfiI CCNNNNNNNGG 2 cut(s) 149, 343
AflIII ACRYGT 1 cut(s) 510
AgsI TTSAA 2 cut(s) 110, 133
AjnI CCWGG 4 cut(s) 117, 142, 336, 445
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
Alw26I GTCTC 1 cut(s) 170
AlwI GGATC 3 cut(s) 265, 352, 437
AoxI GGCC 2 cut(s) 115, 121
ApeKI GCWGC 1 cut(s) 522
ApoI RAATTY 1 cut(s) 332
AspS9I GGNCC 1 cut(s) 121
AsuHPI GGTGA 4 cut(s) 13, 341, 352, 379
BbvI GCAGC 1 cut(s) 534
BccI CCATC 2 cut(s) 32, 248
BciT130I CCWGG 4 cut(s) 119, 144, 338, 447
BcoDI GTCTC 1 cut(s) 170
BfaI CTAG 1 cut(s) 218
BfmI CTRYAG 2 cut(s) 279, 389
BisI GCNGC 1 cut(s) 523
BlsI GCNGC 1 cut(s) 524
Bme1390I CCNGG 4 cut(s) 119, 144, 338, 447
BmgT120I GGNCC 1 cut(s) 121
BmrFI CCNGG 4 cut(s) 119, 144, 338, 447
BmsI GCATC 2 cut(s) 27, 245
BplI GAGNNNNNCTC 2 cut(s) 254, 286
Bpu10I CCTNAGC 1 cut(s) 246
BsaBI GATNNNNATC 1 cut(s) 210
BsaJI CCNNGG 4 cut(s) 118, 142, 479, 534
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 343
Bse1I ACTGG 1 cut(s) 154
Bse8I GATNNNNATC 1 cut(s) 210
BseBI CCWGG 4 cut(s) 119, 144, 338, 447
BseDI CCNNGG 4 cut(s) 118, 142, 479, 534
BseGI GGATG 3 cut(s) 236, 381, 430
BseJI GATNNNNATC 1 cut(s) 210
BseLI CCNNNNNNNGG 2 cut(s) 149, 343
BseMII CTCAG 2 cut(s) 237, 317
BseNI ACTGG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 74
BseXI GCAGC 1 cut(s) 534
BsgI GTGCAG 1 cut(s) 541
BshFI GGCC 2 cut(s) 117, 123
BslFI GGGAC 1 cut(s) 497
BslI CCNNNNNNNGG 2 cut(s) 149, 343
BsmAI GTCTC 1 cut(s) 170
BsmFI GGGAC 1 cut(s) 497
BsmI GAATGC 1 cut(s) 461
BsnI GGCC 2 cut(s) 117, 123
Bsp143I GATC 3 cut(s) 257, 357, 442
BspACI CCGC 1 cut(s) 525
BspANI GGCC 2 cut(s) 117, 123
BspCNI CTCAG 2 cut(s) 238, 316
BspPI GGATC 3 cut(s) 265, 352, 437
BsrI ACTGG 1 cut(s) 154
BssECI CCNNGG 4 cut(s) 118, 142, 479, 534
BssMI GATC 3 cut(s) 257, 357, 442
BssT1I CCWWGG 1 cut(s) 534
Bst2UI CCWGG 4 cut(s) 119, 144, 338, 447
Bst4CI ACNGT 3 cut(s) 56, 100, 493
BstC8I GCNNGC 1 cut(s) 199
BstDEI CTNAG 2 cut(s) 246, 303
BstDSI CCRYGG 1 cut(s) 479
BstF5I GGATG 3 cut(s) 236, 381, 430
BstKTI GATC 3 cut(s) 260, 360, 445
BstMAI GTCTC 1 cut(s) 170
BstMBI GATC 3 cut(s) 257, 357, 442
BstMWI GCNNNNNNNGC 2 cut(s) 227, 465
BstNI CCWGG 4 cut(s) 119, 144, 338, 447
BstNSI RCATGY 1 cut(s) 514
BstSCI CCNGG 4 cut(s) 117, 142, 336, 445
BstSFI CTRYAG 2 cut(s) 279, 389
BstV1I GCAGC 1 cut(s) 534
BstX2I RGATCY 1 cut(s) 357
BstYI RGATCY 1 cut(s) 357
BsuRI GGCC 2 cut(s) 117, 123
BtgI CCRYGG 1 cut(s) 479
BtsCI GGATG 3 cut(s) 236, 381, 430
BtsI GCAGTG 1 cut(s) 228
BtsIMutI CAGTG 1 cut(s) 228
Cac8I GCNNGC 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 121
CseI GACGC 1 cut(s) 448
Csp6I GTAC 1 cut(s) 101
CviAII CATG 3 cut(s) 251, 501, 511
CviJI RGCY 6 cut(s) 5, 117, 123, 197, 201, 308
CviKI_1 RGCY 6 cut(s) 5, 117, 123, 197, 201, 308
CviQI GTAC 1 cut(s) 101
DdeI CTNAG 2 cut(s) 246, 303
DpnI GATC 3 cut(s) 259, 359, 444
DpnII GATC 3 cut(s) 257, 357, 442
Eco130I CCWWGG 1 cut(s) 534
Eco147I AGGCCT 1 cut(s) 117
Eco32I GATATC 1 cut(s) 208
EcoRI GAATTC 1 cut(s) 332
EcoRII CCWGG 4 cut(s) 117, 142, 336, 445
EcoRV GATATC 1 cut(s) 208
EcoT14I CCWWGG 1 cut(s) 534
ErhI CCWWGG 1 cut(s) 534
FaeI CATG 3 cut(s) 254, 504, 514
FaiI YATR 7 cut(s) 252, 384, 400, 402, 502, 512, 518
FaqI GGGAC 1 cut(s) 497
FatI CATG 3 cut(s) 250, 500, 510
FauI CCCGC 1 cut(s) 518
Fnu4HI GCNGC 1 cut(s) 523
FokI GGATG 3 cut(s) 223, 388, 437
Fsp4HI GCNGC 1 cut(s) 523
FspBI CTAG 1 cut(s) 218
GluI GCNGC 1 cut(s) 523
HaeIII GGCC 2 cut(s) 117, 123
HgaI GACGC 1 cut(s) 448
Hin1II CATG 3 cut(s) 254, 504, 514
HphI GGTGA 4 cut(s) 13, 341, 352, 379
Hpy166II GTNNAC 1 cut(s) 103
Hpy188I TCNGA 2 cut(s) 262, 475
Hpy8I GTNNAC 1 cut(s) 103
HpyAV CCTTC 2 cut(s) 38, 220
HpyCH4III ACNGT 3 cut(s) 56, 100, 493
HpyCH4V TGCA 2 cut(s) 38, 522
HpyF10VI GCNNNNNNNGC 2 cut(s) 227, 465
HpyF3I CTNAG 2 cut(s) 246, 303
Hsp92II CATG 3 cut(s) 254, 504, 514
Kzo9I GATC 3 cut(s) 257, 357, 442
Lsp1109I GCAGC 1 cut(s) 534
LweI GCATC 2 cut(s) 27, 245
MaeI CTAG 1 cut(s) 218
MaeIII GTNAC 3 cut(s) 56, 94, 183
MalI GATC 3 cut(s) 259, 359, 444
MboI GATC 3 cut(s) 257, 357, 442
MboII GAAGA 2 cut(s) 22, 488
MflI RGATCY 1 cut(s) 357
MluCI AATT 5 cut(s) 153, 332, 405, 412, 567
MseI TTAA 2 cut(s) 78, 156
MslI CAYNNNNRTG 1 cut(s) 515
MspA1I CMGCKG 1 cut(s) 525
MspR9I CCNGG 4 cut(s) 119, 144, 338, 447
Mva1269I GAATGC 1 cut(s) 461
MvaI CCWGG 4 cut(s) 119, 144, 338, 447
MwoI GCNNNNNNNGC 2 cut(s) 227, 465
NdeII GATC 3 cut(s) 257, 357, 442
NlaIII CATG 3 cut(s) 254, 504, 514
NmuCI GTSAC 1 cut(s) 94
NspI RCATGY 1 cut(s) 514
PceI AGGCCT 1 cut(s) 117
PciI ACATGT 1 cut(s) 510
PctI GAATGC 1 cut(s) 461
PfoI TCCNGGA 1 cut(s) 445
PkrI GCNGC 1 cut(s) 524
PscI ACATGT 1 cut(s) 510
Psp6I CCWGG 4 cut(s) 117, 142, 336, 445
PspGI CCWGG 4 cut(s) 117, 142, 336, 445
PspPI GGNCC 1 cut(s) 121
PsuI RGATCY 1 cut(s) 357
RsaI GTAC 1 cut(s) 102
RsaNI GTAC 1 cut(s) 101
RseI CAYNNNNRTG 1 cut(s) 515
SaqAI TTAA 2 cut(s) 78, 156
SatI GCNGC 1 cut(s) 523
Sau3AI GATC 3 cut(s) 257, 357, 442
Sau96I GGNCC 1 cut(s) 121
ScrFI CCNGG 4 cut(s) 119, 144, 338, 447
SetI ASST 9 cut(s) 63, 84, 94, 199, 247, 331, 342, 383, 540
SfaNI GCATC 2 cut(s) 27, 245
SfcI CTRYAG 2 cut(s) 279, 389
SmiMI CAYNNNNRTG 1 cut(s) 515
Sse9I AATT 5 cut(s) 153, 332, 405, 412, 567
SseBI AGGCCT 1 cut(s) 117
SsiI CCGC 1 cut(s) 525
SspMI CTAG 1 cut(s) 218
StuI AGGCCT 1 cut(s) 117
StyD4I CCNGG 4 cut(s) 117, 142, 336, 445
StyI CCWWGG 1 cut(s) 534
TaaI ACNGT 3 cut(s) 56, 100, 493
TaqI TCGA 1 cut(s) 420
TasI AATT 5 cut(s) 153, 332, 405, 412, 567
TatI WGTACW 1 cut(s) 100
Tru1I TTAA 2 cut(s) 78, 156
Tru9I TTAA 2 cut(s) 78, 156
TscAI CASTG 1 cut(s) 228
TseFI GTSAC 1 cut(s) 94
TseI GCWGC 1 cut(s) 522
Tsp45I GTSAC 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 399
TspRI CASTG 1 cut(s) 228
XapI RAATTY 1 cut(s) 332
XceI RCATGY 1 cut(s) 514
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.