Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009045.1

Orthogroup ID

OG0014689

Physical Location & Seq

Genomic Coordinates Reverse (-)

5466 .. 5828

Gene Structure 363 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009045.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

atgagagactttgatacaactcgtgattcgaagattgatgttgatgaattcttcaaagggatttcaaggtgtaacaaggctaagcgtgctgcaatgatggactgtggaaaggttccgctatcaatgaaactgtttgatgattttgataagttaacaaaggaagaacaagatcggtatggggatcagattgatgagattgtaggaggatattataaatgcaaactggcatgcctcaaaagcagtactgatgttgcttctgggaaccattgttgctgctgtgattgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EF-hand_7 Na_Ca_ex

Protein Analysis

95

Amino Acids

10.77

Weight (kDa)

5.32

Isoelectric Point (pI)

26.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014689)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g10820 FvH4_6g26990 FvH4_6g26990 FvH4_6g26990 FvH4_6g26990
malus_domestica	MD11G1258500.v1.1
rosa_chinensis	RchiOBHm_Chr2g0129111 RchiOBHm_Chr2g0129121
rosa_laevigata	RLG00000019056
rosa_multiflora	Rmu_sc0009045.1_g000002
rosa_roxburghii	Rroxscaffold_2G00114840
rosa_rugosa	Rorug02G0284900
rosa_samantha	Rh2AG337000 Rh2BG345000 Rh2CG324400 Rh2DG361800
rosa_wichuraiana	Rw2G027330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	213
AciI	CCGC	1 cut(s)	116
AclWI	GGATC	1 cut(s)	189
AcsI	RAATTY	1 cut(s)	47
AfaI	GTAC	1 cut(s)	244
AgsI	TTSAA	2 cut(s)	55, 66
AlwI	GGATC	1 cut(s)	189
ApeKI	GCWGC	2 cut(s)	89, 273
ApoI	RAATTY	1 cut(s)	47
AsuII	TTCGAA	1 cut(s)	29
BauI	CACGAG	1 cut(s)	21
BbvI	GCAGC	2 cut(s)	76, 260
BccI	CCATC	1 cut(s)	91
BisI	GCNGC	2 cut(s)	90, 274
BlpI	GCTNAGC	1 cut(s)	81
BlsI	GCNGC	2 cut(s)	91, 275
BmcAI	AGTACT	1 cut(s)	244
BmiI	GGNNCC	2 cut(s)	114, 263
Bpu1102I	GCTNAGC	1 cut(s)	81
Bpu14I	TTCGAA	1 cut(s)	29
Bse1I	ACTGG	1 cut(s)	228
Bse3DI	GCAATG	1 cut(s)	99
BseMI	GCAATG	1 cut(s)	99
BseNI	ACTGG	1 cut(s)	228
BseXI	GCAGC	2 cut(s)	76, 260
Bsp119I	TTCGAA	1 cut(s)	29
Bsp143I	GATC	2 cut(s)	169, 181
Bsp1720I	GCTNAGC	1 cut(s)	81
BspACI	CCGC	1 cut(s)	116
BspLI	GGNNCC	2 cut(s)	114, 263
BspPI	GGATC	1 cut(s)	189
BspT104I	TTCGAA	1 cut(s)	29
BsrDI	GCAATG	1 cut(s)	99
BsrI	ACTGG	1 cut(s)	228
BssMI	GATC	2 cut(s)	169, 181
BssSI	CACGAG	1 cut(s)	21
Bst2BI	CACGAG	1 cut(s)	21
Bst4CI	ACNGT	2 cut(s)	104, 132
BstBI	TTCGAA	1 cut(s)	29
BstC8I	GCNNGC	2 cut(s)	87, 229
BstDEI	CTNAG	1 cut(s)	81
BstKTI	GATC	2 cut(s)	172, 184
BstMBI	GATC	2 cut(s)	169, 181
BstMWI	GCNNNNNNNGC	3 cut(s)	86, 237, 282
BstNSI	RCATGY	1 cut(s)	231
BstV1I	GCAGC	2 cut(s)	76, 260
Cac8I	GCNNGC	2 cut(s)	87, 229
Csp6I	GTAC	1 cut(s)	243
CviAII	CATG	1 cut(s)	228
CviJI	RGCY	1 cut(s)	80
CviKI_1	RGCY	1 cut(s)	80
CviQI	GTAC	1 cut(s)	243
DdeI	CTNAG	1 cut(s)	81
DpnI	GATC	2 cut(s)	171, 183
DpnII	GATC	2 cut(s)	169, 181
EcoRI	GAATTC	1 cut(s)	47
FaeI	CATG	1 cut(s)	231
FaiI	YATR	3 cut(s)	177, 213, 229
FatI	CATG	1 cut(s)	227
Fnu4HI	GCNGC	2 cut(s)	90, 274
Fsp4HI	GCNGC	2 cut(s)	90, 274
GluI	GCNGC	2 cut(s)	90, 274
Hin1II	CATG	1 cut(s)	231
HincII	GTYRAC	1 cut(s)	153
HindII	GTYRAC	1 cut(s)	153
HinfI	GANTC	1 cut(s)	26
HpaI	GTTAAC	1 cut(s)	153
Hpy166II	GTNNAC	1 cut(s)	153
Hpy188I	TCNGA	1 cut(s)	186
Hpy188III	TCNNGA	1 cut(s)	23
Hpy8I	GTNNAC	1 cut(s)	153
HpyCH4III	ACNGT	2 cut(s)	104, 132
HpyCH4V	TGCA	2 cut(s)	92, 219
HpyF10VI	GCNNNNNNNGC	3 cut(s)	86, 237, 282
HpyF3I	CTNAG	1 cut(s)	81
Hsp92II	CATG	1 cut(s)	231
KspAI	GTTAAC	1 cut(s)	153
Kzo9I	GATC	2 cut(s)	169, 181
LpnPI	CCDG	2 cut(s)	209, 243
Lsp1109I	GCAGC	2 cut(s)	76, 260
MaeIII	GTNAC	1 cut(s)	71
MalI	GATC	2 cut(s)	171, 183
MboI	GATC	2 cut(s)	169, 181
MboII	GAAGA	3 cut(s)	43, 43, 173
MluCI	AATT	1 cut(s)	47
MnlI	CCTC	2 cut(s)	197, 242
MseI	TTAA	1 cut(s)	152
MwoI	GCNNNNNNNGC	3 cut(s)	86, 237, 282
NdeII	GATC	2 cut(s)	169, 181
NlaIII	CATG	1 cut(s)	231
NlaIV	GGNNCC	2 cut(s)	114, 263
NspI	RCATGY	1 cut(s)	231
NspV	TTCGAA	1 cut(s)	29
PaeI	GCATGC	1 cut(s)	231
PfeI	GAWTC	1 cut(s)	26
PkrI	GCNGC	2 cut(s)	91, 275
PsiI	TTATAA	1 cut(s)	213
PspN4I	GGNNCC	2 cut(s)	114, 263
RsaI	GTAC	1 cut(s)	244
RsaNI	GTAC	1 cut(s)	243
SaqAI	TTAA	1 cut(s)	152
SatI	GCNGC	2 cut(s)	90, 274
Sau3AI	GATC	2 cut(s)	169, 181
ScaI	AGTACT	1 cut(s)	244
SetI	ASST	2 cut(s)	71, 114
SfuI	TTCGAA	1 cut(s)	29
SgeI	CNNG	9 cut(s)	33, 35, 78, 88, 98, 179, 236, 240, 270
SphI	GCATGC	1 cut(s)	231
Sse9I	AATT	1 cut(s)	47
SsiI	CCGC	1 cut(s)	116
TaaI	ACNGT	2 cut(s)	104, 132
TaqI	TCGA	1 cut(s)	29
TasI	AATT	1 cut(s)	47
TatI	WGTACW	1 cut(s)	242
TfiI	GAWTC	1 cut(s)	26
Tru1I	TTAA	1 cut(s)	152
Tru9I	TTAA	1 cut(s)	152
TseI	GCWGC	2 cut(s)	89, 273
TspDTI	ATGAA	2 cut(s)	60, 140
XapI	RAATTY	1 cut(s)	47
XceI	RCATGY	1 cut(s)	231
ZrmI	AGTACT	1 cut(s)	244

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.