Rh2CG324400

Sodium/calcium exchanger protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
41764041 .. 41765713
1673 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG324400.1

Sequence Viewer

Length: 207 bp
ATGAGAGACTTTGATACAACTCGTGATTCGAAGATTGATGTTGATGAATTCTTCAAAGGAATTTCAAGGTGTAACAAGGCTAAGCGTGCTGCAATGATGGACTGTGGAAAGGTTCCGCTATCAATGAAACTGTTTGATGATTTTGATAAGGTATATATAGCAATGAGGGTTGCGTTAATTACAAAGAAAAGCCAGTTTGGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.83

Weight (kDa)

9.3

Isoelectric Point (pI)

11.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 116
AcsI RAATTY 2 cut(s) 47, 60
AgsI TTSAA 2 cut(s) 55, 66
ApeKI GCWGC 1 cut(s) 89
ApoI RAATTY 2 cut(s) 47, 60
AsuII TTCGAA 1 cut(s) 29
BauI CACGAG 1 cut(s) 21
BbvI GCAGC 1 cut(s) 76
BccI CCATC 1 cut(s) 91
BisI GCNGC 1 cut(s) 90
BlpI GCTNAGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 114
Bpu1102I GCTNAGC 1 cut(s) 81
Bpu14I TTCGAA 1 cut(s) 29
Bse1I ACTGG 1 cut(s) 193
Bse3DI GCAATG 2 cut(s) 99, 168
BseMI GCAATG 2 cut(s) 99, 168
BseNI ACTGG 1 cut(s) 193
BseXI GCAGC 1 cut(s) 76
Bsp119I TTCGAA 1 cut(s) 29
Bsp1720I GCTNAGC 1 cut(s) 81
BspACI CCGC 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 114
BspT104I TTCGAA 1 cut(s) 29
BsrDI GCAATG 2 cut(s) 99, 168
BsrI ACTGG 1 cut(s) 193
BssSI CACGAG 1 cut(s) 21
Bst2BI CACGAG 1 cut(s) 21
Bst4CI ACNGT 2 cut(s) 104, 132
BstBI TTCGAA 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 81
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstV1I GCAGC 1 cut(s) 76
Cac8I GCNNGC 1 cut(s) 87
CviJI RGCY 2 cut(s) 80, 192
CviKI_1 RGCY 2 cut(s) 80, 192
DdeI CTNAG 1 cut(s) 81
EcoRI GAATTC 1 cut(s) 47
FaiI YATR 3 cut(s) 154, 156, 158
Fnu4HI GCNGC 1 cut(s) 90
Fsp4HI GCNGC 1 cut(s) 90
GluI GCNGC 1 cut(s) 90
HinfI GANTC 1 cut(s) 26
Hpy188III TCNNGA 1 cut(s) 23
HpyCH4III ACNGT 2 cut(s) 104, 132
HpyCH4V TGCA 1 cut(s) 92
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 81
Lsp1109I GCAGC 1 cut(s) 76
MaeIII GTNAC 1 cut(s) 71
MboII GAAGA 2 cut(s) 43, 43
MluCI AATT 3 cut(s) 47, 60, 177
MnlI CCTC 1 cut(s) 159
MseI TTAA 1 cut(s) 176
MwoI GCNNNNNNNGC 1 cut(s) 86
NlaIV GGNNCC 1 cut(s) 114
NspV TTCGAA 1 cut(s) 29
PfeI GAWTC 1 cut(s) 26
PkrI GCNGC 1 cut(s) 91
PspN4I GGNNCC 1 cut(s) 114
SaqAI TTAA 1 cut(s) 176
SatI GCNGC 1 cut(s) 90
SetI ASST 3 cut(s) 71, 114, 153
SfuI TTCGAA 1 cut(s) 29
SgeI CNNG 5 cut(s) 33, 35, 78, 88, 98
Sse9I AATT 3 cut(s) 47, 60, 177
SsiI CCGC 1 cut(s) 116
TaaI ACNGT 2 cut(s) 104, 132
TaqI TCGA 1 cut(s) 29
TasI AATT 3 cut(s) 47, 60, 177
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TseI GCWGC 1 cut(s) 89
TspDTI ATGAA 2 cut(s) 60, 140
XapI RAATTY 2 cut(s) 47, 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.