Rmu_sc0010407.1_g000023

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010407.1
Physical Location & Seq
Forward (+)
72411 .. 75006
2596 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010407.1_g000023.1.cds

Sequence Viewer

Length: 1122 bp
atggctaagcactactttaggctattttcttctgctttgcttgttttgtccttcatggtggtgcaggctgaagtagtttggggtcaagatggtactgaaaggaggaaagaaatggtgcctgcaatgttcatattcggagactctctgattgacaatggcaacaacaacaacctcccttcatttgccaaggccaactatcccccctatggaatcgatttcaatggcggaccaactggtcgttttagcaatggttacaccatggttgatgaaatagctgaattgctaggacttcctttaattcctgcgtactctgaagcttctggagatcaagtgcttcatggtgtcaattatgcatctgcagccgctggaatccttgatatcactggcagaaactttgtgggtcgcataccctttggtcaacaaataagcaacttccagactacagttgatcagataacggagactctgggtgcagatgatgttgcccgggccattgcaaagtgcatattctttgttggaatgggcagcaatgactacctaaacaattaccttatgcccaactataacaccaagaatcaatacaatgctcaacaatttgctgatctcttggctcaacaatacactcagcaactcactaggctctacaatcttggtgctcgaagatttgttattgctggagttgggaggatgggttgcataccaagtatcttagcccaaagtccaaatggaagctgctcagaggacgtcaatcgccttgttctacccttcaacgcaaatgtgaagacaatgatcaacaatcttaataccaacttacctggttcgaggttcatttacattgacattgctcgaatgtttgaagacgtcgtcaccaatgctagagcttatggattcagtgttgcgaatcgtggatgctgtggtattgggcgtaacagagggcaaattacatgtcttccaatgcaaacaccgtgcccaaatcgtgaccagtacgtgttctgggatgcatatcacccaactgcagctgtgaacatcttaattggcaggaaagctttcagtggagaccctagccaggtttaccccatgaacatacagcagcttgccactcttaacattgaaaccaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

373

Amino Acids

41.11

Weight (kDa)

6.31

Isoelectric Point (pI)

31.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 234
AatII GACGTC 2 cut(s) 747, 864
AccB1I GGYRCC 1 cut(s) 115
AciI CCGC 2 cut(s) 225, 363
AcuI CTGAAG 2 cut(s) 90, 333
AcyI GRCGYC 2 cut(s) 744, 861
AfaI GTAC 3 cut(s) 94, 308, 986
AfiI CCNNNNNNNGG 2 cut(s) 206, 1066
AflIII ACRYGT 2 cut(s) 944, 987
AgsI TTSAA 4 cut(s) 220, 769, 857, 1112
AjnI CCWGG 2 cut(s) 814, 1065
AluBI AGCT 7 cut(s) 275, 317, 732, 881, 1019, 1046, 1093
AluI AGCT 7 cut(s) 275, 317, 732, 881, 1019, 1046, 1093
Alw21I GWGCWC 1 cut(s) 658
Alw26I GTCTC 3 cut(s) 132, 455, 1050
AlwNI CAGNNNCTG 1 cut(s) 365
Ama87I CYCGRG 1 cut(s) 486
AoxI GGCC 2 cut(s) 189, 489
ApeKI GCWGC 5 cut(s) 359, 525, 732, 1016, 1090
ArsI GACNNNNNNTTYG 2 cut(s) 931, 963
Asp700I GAANNNNTTC 1 cut(s) 1046
AspS9I GGNCC 2 cut(s) 227, 489
AsuC2I CCSGG 2 cut(s) 487, 488
AsuHPI GGTGA 2 cut(s) 859, 998
AvaI CYCGRG 1 cut(s) 486
AvaII GGWCC 1 cut(s) 227
BaeGI GKGCMC 1 cut(s) 971
BanI GGYRCC 1 cut(s) 115
BbsI GAAGAC 3 cut(s) 788, 864, 941
Bbv12I GWGCWC 1 cut(s) 658
BbvI GCAGC 5 cut(s) 371, 537, 719, 1028, 1102
BccI CCATC 2 cut(s) 83, 682
BciT130I CCWGG 2 cut(s) 816, 1067
BclI TGATCA 2 cut(s) 448, 789
BcnI CCSGG 2 cut(s) 487, 488
BcoDI GTCTC 3 cut(s) 132, 455, 1050
BfaI CTAG 4 cut(s) 284, 636, 876, 1062
BfmI CTRYAG 3 cut(s) 357, 441, 1014
BisI GCNGC 6 cut(s) 360, 363, 526, 733, 1017, 1091
BlpI GCTNAGC 1 cut(s) 6
BlsI GCNGC 6 cut(s) 361, 364, 527, 734, 1018, 1092
Bme1390I CCNGG 4 cut(s) 487, 488, 816, 1067
Bme18I GGWCC 1 cut(s) 227
BmeT110I CYCGRG 1 cut(s) 486
BmgT120I GGNCC 2 cut(s) 227, 489
BmiI GGNNCC 1 cut(s) 117
BmrFI CCNGG 4 cut(s) 487, 488, 816, 1067
BmsI GCATC 3 cut(s) 362, 899, 988
BpiI GAAGAC 3 cut(s) 788, 864, 941
BpmI CTGGAG 2 cut(s) 342, 696
Bpu1102I GCTNAGC 1 cut(s) 6
BpuMI CCSGG 2 cut(s) 487, 488
Bsa29I ATCGAT 1 cut(s) 213
BsaAI YACGTR 1 cut(s) 988
BsaBI GATNNNNATC 1 cut(s) 1002
BsaHI GRCGYC 2 cut(s) 744, 861
BsaI GGTCTC 1 cut(s) 1050
BsaJI CCNNGG 3 cut(s) 186, 258, 486
BsaXI ACNNNNNCTCC 4 cut(s) 315, 345, 676, 706
Bsc4I CCNNNNNNNGG 2 cut(s) 206, 1066
Bse1I ACTGG 3 cut(s) 238, 388, 982
Bse3DI GCAATG 5 cut(s) 129, 253, 492, 535, 840
Bse8I GATNNNNATC 1 cut(s) 1002
BseBI CCWGG 2 cut(s) 816, 1067
BseCI ATCGAT 1 cut(s) 213
BseDI CCNNGG 3 cut(s) 186, 258, 486
BseGI GGATG 3 cut(s) 693, 914, 1003
BseJI GATNNNNATC 1 cut(s) 1002
BseLI CCNNNNNNNGG 2 cut(s) 206, 1066
BseMI GCAATG 5 cut(s) 129, 253, 492, 535, 840
BseMII CTCAG 2 cut(s) 638, 750
BseNI ACTGG 3 cut(s) 238, 388, 982
BseSI GKGCMC 1 cut(s) 971
BseXI GCAGC 5 cut(s) 371, 537, 719, 1028, 1102
BsgI GTGCAG 2 cut(s) 83, 492
BshFI GGCC 2 cut(s) 191, 491
BshNI GGYRCC 1 cut(s) 115
BshVI ATCGAT 1 cut(s) 213
BsiHKAI GWGCWC 1 cut(s) 658
BsiHKCI CYCGRG 1 cut(s) 486
BsiSI CCGG 1 cut(s) 487
BslI CCNNNNNNNGG 2 cut(s) 206, 1066
BsmAI GTCTC 3 cut(s) 132, 455, 1050
BsnI GGCC 2 cut(s) 191, 491
Bso31I GGTCTC 1 cut(s) 1050
BsoBI CYCGRG 1 cut(s) 486
Bsp1286I GDGCHC 2 cut(s) 658, 971
Bsp143I GATC 4 cut(s) 325, 448, 601, 789
Bsp1720I GCTNAGC 1 cut(s) 6
Bsp19I CCATGG 1 cut(s) 258
BspACI CCGC 2 cut(s) 225, 363
BspANI GGCC 2 cut(s) 191, 491
BspCNI CTCAG 2 cut(s) 637, 749
BspDI ATCGAT 1 cut(s) 213
BspLI GGNNCC 1 cut(s) 117
BspMAI CTGCAG 2 cut(s) 361, 1018
BspT107I GGYRCC 1 cut(s) 115
BspTNI GGTCTC 1 cut(s) 1050
BsrDI GCAATG 5 cut(s) 129, 253, 492, 535, 840
BsrI ACTGG 3 cut(s) 238, 388, 982
BssECI CCNNGG 3 cut(s) 186, 258, 486
BssMI GATC 4 cut(s) 325, 448, 601, 789
BssNI GRCGYC 2 cut(s) 744, 861
BssT1I CCWWGG 2 cut(s) 186, 258
Bst2UI CCWGG 2 cut(s) 816, 1067
Bst4CI ACNGT 2 cut(s) 445, 966
BstACI GRCGYC 2 cut(s) 744, 861
BstBAI YACGTR 1 cut(s) 988
BstC8I GCNNGC 3 cut(s) 66, 120, 1095
BstDEI CTNAG 4 cut(s) 6, 624, 709, 736
BstDSI CCRYGG 1 cut(s) 258
BstF5I GGATG 3 cut(s) 693, 914, 1003
BstKTI GATC 4 cut(s) 328, 451, 604, 792
BstMAI GTCTC 3 cut(s) 132, 455, 1050
BstMBI GATC 4 cut(s) 325, 448, 601, 789
BstMWI GCNNNNNNNGC 1 cut(s) 359
BstNI CCWGG 2 cut(s) 816, 1067
BstNSI RCATGY 1 cut(s) 948
BstSCI CCNGG 4 cut(s) 485, 486, 814, 1065
BstSFI CTRYAG 3 cut(s) 357, 441, 1014
BstSLI GKGCMC 1 cut(s) 971
BstV1I GCAGC 5 cut(s) 371, 537, 719, 1028, 1102
BstV2I GAAGAC 3 cut(s) 788, 864, 941
Bsu15I ATCGAT 1 cut(s) 213
BsuRI GGCC 2 cut(s) 191, 491
BsuTUI ATCGAT 1 cut(s) 213
BtgI CCRYGG 1 cut(s) 258
BtsCI GGATG 3 cut(s) 693, 914, 1003
BtsIMutI CAGTG 3 cut(s) 381, 898, 1057
Cac8I GCNNGC 3 cut(s) 66, 120, 1095
CaiI CAGNNNCTG 1 cut(s) 365
Cfr13I GGNCC 2 cut(s) 227, 489
Cfr9I CCCGGG 1 cut(s) 486
ClaI ATCGAT 1 cut(s) 213
CsiI ACCWGGT 1 cut(s) 814
Csp6I GTAC 3 cut(s) 93, 307, 985
CviAII CATG 5 cut(s) 55, 259, 338, 945, 1078
CviQI GTAC 3 cut(s) 93, 307, 985
DdeI CTNAG 4 cut(s) 6, 624, 709, 736
DpnI GATC 4 cut(s) 327, 450, 603, 791
DpnII GATC 4 cut(s) 325, 448, 601, 789
DrdI GACNNNNNNGTC 1 cut(s) 234
DseDI GACNNNNNNGTC 1 cut(s) 234
EciI GGCGGA 1 cut(s) 240
Eco130I CCWWGG 2 cut(s) 186, 258
Eco31I GGTCTC 1 cut(s) 1050
Eco32I GATATC 1 cut(s) 379
Eco47I GGWCC 1 cut(s) 227
Eco57I CTGAAG 2 cut(s) 90, 333
Eco88I CYCGRG 1 cut(s) 486
EcoRII CCWGG 2 cut(s) 814, 1065
EcoRV GATATC 1 cut(s) 379
EcoT14I CCWWGG 2 cut(s) 186, 258
EcoT22I ATGCAT 2 cut(s) 355, 1003
ErhI CCWWGG 2 cut(s) 186, 258
FaeI CATG 5 cut(s) 58, 262, 341, 948, 1081
FalI AAGNNNNNCTT 1 cut(s) 31
FatI CATG 5 cut(s) 54, 258, 337, 944, 1077
FbaI TGATCA 2 cut(s) 448, 789
Fnu4HI GCNGC 6 cut(s) 360, 363, 526, 733, 1017, 1091
FokI GGATG 3 cut(s) 700, 921, 1010
Fsp4HI GCNGC 6 cut(s) 360, 363, 526, 733, 1017, 1091
FspBI CTAG 4 cut(s) 284, 636, 876, 1062
GluI GCNGC 6 cut(s) 360, 363, 526, 733, 1017, 1091
GsuI CTGGAG 2 cut(s) 342, 696
HaeIII GGCC 2 cut(s) 191, 491
HapII CCGG 1 cut(s) 487
Hin1I GRCGYC 2 cut(s) 744, 861
Hin1II CATG 5 cut(s) 58, 262, 341, 948, 1081
HincII GTYRAC 1 cut(s) 419
HindII GTYRAC 1 cut(s) 419
HindIII AAGCTT 2 cut(s) 315, 1044
HinfI GANTC 7 cut(s) 140, 210, 369, 463, 574, 888, 901
HpaII CCGG 1 cut(s) 487
HphI GGTGA 2 cut(s) 859, 998
Hpy166II GTNNAC 3 cut(s) 419, 1024, 1072
Hpy188I TCNGA 5 cut(s) 137, 147, 313, 453, 739
Hpy188III TCNNGA 4 cut(s) 86, 321, 436, 977
Hpy8I GTNNAC 3 cut(s) 419, 1024, 1072
Hpy99I CGWCG 1 cut(s) 866
HpyAV CCTTC 3 cut(s) 61, 186, 775
HpyCH4III ACNGT 2 cut(s) 445, 966
HpyCH4IV ACGT 3 cut(s) 744, 861, 987
HpyF10VI GCNNNNNNNGC 1 cut(s) 359
HpyF3I CTNAG 4 cut(s) 6, 624, 709, 736
HpySE526I ACGT 3 cut(s) 744, 861, 987
Hsp92I GRCGYC 2 cut(s) 744, 861
Hsp92II CATG 5 cut(s) 58, 262, 341, 948, 1081
Ksp22I TGATCA 2 cut(s) 448, 789
Kzo9I GATC 4 cut(s) 325, 448, 601, 789
Lsp1109I GCAGC 5 cut(s) 371, 537, 719, 1028, 1102
LweI GCATC 3 cut(s) 362, 899, 988
MabI ACCWGGT 1 cut(s) 814
MaeI CTAG 4 cut(s) 284, 636, 876, 1062
MaeII ACGT 3 cut(s) 744, 861, 987
MaeIII GTNAC 4 cut(s) 251, 865, 926, 977
MalI GATC 4 cut(s) 327, 450, 603, 791
MboI GATC 4 cut(s) 325, 448, 601, 789
MboII GAAGA 5 cut(s) 21, 672, 793, 869, 941
MhlI GDGCHC 2 cut(s) 658, 971
MluCI AATT 8 cut(s) 278, 297, 346, 544, 593, 939, 1032, 1117
MlyI GAGTC 2 cut(s) 134, 457
MmeI TCCRAC 1 cut(s) 496
MnlI CCTC 6 cut(s) 96, 182, 678, 733, 816, 926
Mph1103I ATGCAT 2 cut(s) 355, 1003
MroXI GAANNNNTTC 1 cut(s) 1046
MseI TTAA 4 cut(s) 296, 801, 1031, 1104
MslI CAYNNNNRTG 1 cut(s) 59
MspA1I CMGCKG 2 cut(s) 365, 1019
MspI CCGG 1 cut(s) 487
MspR9I CCNGG 4 cut(s) 487, 488, 816, 1067
MvaI CCWGG 2 cut(s) 816, 1067
MwoI GCNNNNNNNGC 1 cut(s) 359
NciI CCSGG 2 cut(s) 487, 488
NcoI CCATGG 1 cut(s) 258
NdeII GATC 4 cut(s) 325, 448, 601, 789
NlaIII CATG 5 cut(s) 58, 262, 341, 948, 1081
NlaIV GGNNCC 1 cut(s) 117
NmuCI GTSAC 2 cut(s) 865, 977
NsiI ATGCAT 2 cut(s) 355, 1003
NspI RCATGY 1 cut(s) 948
PciI ACATGT 1 cut(s) 944
PdmI GAANNNNTTC 1 cut(s) 1046
PfeI GAWTC 5 cut(s) 210, 369, 574, 888, 901
PflFI GACNNNGTC 1 cut(s) 863
PkrI GCNGC 6 cut(s) 361, 364, 527, 734, 1018, 1092
PleI GAGTC 2 cut(s) 134, 457
PpsI GAGTC 2 cut(s) 134, 457
Ppu21I YACGTR 1 cut(s) 988
PscI ACATGT 1 cut(s) 944
Psp6I CCWGG 2 cut(s) 814, 1065
PspGI CCWGG 2 cut(s) 814, 1065
PspN4I GGNNCC 1 cut(s) 117
PspPI GGNCC 2 cut(s) 227, 489
PstI CTGCAG 2 cut(s) 361, 1018
PstNI CAGNNNCTG 1 cut(s) 365
PsyI GACNNNGTC 1 cut(s) 863
PvuII CAGCTG 1 cut(s) 1019
RsaI GTAC 3 cut(s) 94, 308, 986
RsaNI GTAC 3 cut(s) 93, 307, 985
RseI CAYNNNNRTG 1 cut(s) 59
SaqAI TTAA 4 cut(s) 296, 801, 1031, 1104
SatI GCNGC 6 cut(s) 360, 363, 526, 733, 1017, 1091
Sau3AI GATC 4 cut(s) 325, 448, 601, 789
Sau96I GGNCC 2 cut(s) 227, 489
SchI GAGTC 2 cut(s) 134, 457
ScrFI CCNGG 4 cut(s) 487, 488, 816, 1067
SduI GDGCHC 2 cut(s) 658, 971
SexAI ACCWGGT 1 cut(s) 814
SfaNI GCATC 3 cut(s) 362, 899, 988
SfcI CTRYAG 3 cut(s) 357, 441, 1014
SinI GGWCC 1 cut(s) 227
SmaI CCCGGG 1 cut(s) 488
SmiMI CAYNNNNRTG 1 cut(s) 59
SrfI GCCCGGGC 1 cut(s) 488
Sse9I AATT 8 cut(s) 278, 297, 346, 544, 593, 939, 1032, 1117
SsiI CCGC 2 cut(s) 225, 363
SspMI CTAG 4 cut(s) 284, 636, 876, 1062
StyD4I CCNGG 4 cut(s) 485, 486, 814, 1065
StyI CCWWGG 2 cut(s) 186, 258
TaaI ACNGT 2 cut(s) 445, 966
TaiI ACGT 3 cut(s) 747, 864, 990
TaqI TCGA 4 cut(s) 213, 658, 821, 847
TasI AATT 8 cut(s) 278, 297, 346, 544, 593, 939, 1032, 1117
TauI GCSGC 1 cut(s) 365
TfiI GAWTC 5 cut(s) 210, 369, 574, 888, 901
Tru1I TTAA 4 cut(s) 296, 801, 1031, 1104
Tru9I TTAA 4 cut(s) 296, 801, 1031, 1104
TscAI CASTG 3 cut(s) 388, 898, 1057
TseFI GTSAC 2 cut(s) 865, 977
TseI GCWGC 5 cut(s) 359, 525, 732, 1016, 1090
Tsp45I GTSAC 2 cut(s) 865, 977
TspDTI ATGAA 7 cut(s) 43, 118, 168, 282, 326, 817, 1094
TspGWI ACGGA 1 cut(s) 473
TspMI CCCGGG 1 cut(s) 486
TspRI CASTG 3 cut(s) 388, 898, 1057
Tth111I GACNNNGTC 1 cut(s) 863
VpaK11BI GGWCC 1 cut(s) 227
XceI RCATGY 1 cut(s) 948
XcmI CCANNNNNNNNNTGG 1 cut(s) 722
XmaI CCCGGG 1 cut(s) 486
XmnI GAANNNNTTC 1 cut(s) 1046
XspI CTAG 4 cut(s) 284, 636, 876, 1062
ZraI GACGTC 2 cut(s) 745, 862
Zsp2I ATGCAT 2 cut(s) 355, 1003
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.