Rmu_sc0012355.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012355.1
Physical Location & Seq
Forward (+)
19629 .. 23163
3535 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012355.1_g000005.1.cds

Sequence Viewer

Length: 753 bp
atgatgatgatgaagaagaagaagaagaatcactgggattttctggaagaaattgaagctcccatgtgggtggatctcacattagaagtcgattcgaacaagcaagatggtgatgatgattggttttacacaagccacttgttccaccaatgttcttctcgtgagttgaagattgcattttctcattctggggaggagagtacggccttgaactttgacttgctaggaccatcttcgccgaagcttccatcttctgtgtctagatcaagaggcaaaaactatgtgagcaagaaatggagaggggacaaccaggttgttccgatagataagcgacaccctgtcaatgttctgagtgggacatcttcctgcgtgacttcggaatccagtaataacatgaaaaccaaaccaagctatgcacatctgaaaggaacttcccgttcaaagtcaagttgggtttctaaaagcagctcaattggaaatggcatgccaagttgctctcagccaatatcttcttgtggggattcaacgtctacggaaaagaaagcagatgaaagcaatacagcaagcgcaattacacatgagagtggtcagcagcaacagcagaatatgggaaaatcaagtcaccctctaagtcaagcaagtgcgcttttgtcactcataaagactgataagacagatgagggaaggaggctctctgcttccaagtgtggtgtggcactggaggaaatttggagatttatcatttgcttctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

250

Amino Acids

27.66

Weight (kDa)

8.66

Isoelectric Point (pI)

53.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 530
AclWI GGATC 1 cut(s) 81
AcsI RAATTY 1 cut(s) 726
AfaI GTAC 1 cut(s) 202
AgsI TTSAA 5 cut(s) 56, 169, 211, 441, 525
AhdI GACNNNNNGTC 1 cut(s) 338
AjnI CCWGG 1 cut(s) 309
AluBI AGCT 4 cut(s) 59, 244, 411, 468
AluI AGCT 4 cut(s) 59, 244, 411, 468
AlwI GGATC 1 cut(s) 81
AoxI GGCC 1 cut(s) 204
ApeKI GCWGC 2 cut(s) 465, 592
ApoI RAATTY 1 cut(s) 726
AspLEI GCGC 2 cut(s) 569, 646
AspS9I GGNCC 1 cut(s) 227
AsuHPI GGTGA 2 cut(s) 122, 614
AsuII TTCGAA 1 cut(s) 95
AvaII GGWCC 1 cut(s) 227
BauI CACGAG 1 cut(s) 159
BbvI GCAGC 2 cut(s) 477, 604
BccI CCATC 3 cut(s) 101, 238, 256
BceAI ACGGC 1 cut(s) 219
BciT130I CCWGG 1 cut(s) 311
BfaI CTAG 2 cut(s) 224, 261
BisI GCNGC 2 cut(s) 466, 593
BlsI GCNGC 2 cut(s) 467, 594
Bme1390I CCNGG 1 cut(s) 311
Bme18I GGWCC 1 cut(s) 227
BmeRI GACNNNNNGTC 1 cut(s) 338
BmgT120I GGNCC 1 cut(s) 227
BmrFI CCNGG 1 cut(s) 311
BmrI ACTGGG 1 cut(s) 43
BmuI ACTGGG 1 cut(s) 43
BpmI CTGGAG 1 cut(s) 740
Bpu14I TTCGAA 1 cut(s) 95
Bse1I ACTGG 3 cut(s) 38, 384, 723
BseBI CCWGG 1 cut(s) 311
BseMII CTCAG 2 cut(s) 341, 512
BseNI ACTGG 3 cut(s) 38, 384, 723
BseRI GAGGAG 1 cut(s) 209
BseXI GCAGC 2 cut(s) 477, 604
BshFI GGCC 1 cut(s) 206
BslFI GGGAC 2 cut(s) 317, 370
BsmFI GGGAC 2 cut(s) 317, 370
BsnI GGCC 1 cut(s) 206
Bsp119I TTCGAA 1 cut(s) 95
Bsp143I GATC 2 cut(s) 73, 263
BspANI GGCC 1 cut(s) 206
BspCNI CTCAG 2 cut(s) 342, 511
BspPI GGATC 1 cut(s) 81
BspT104I TTCGAA 1 cut(s) 95
BsrI ACTGG 3 cut(s) 38, 384, 723
BssMI GATC 2 cut(s) 73, 263
BssSI CACGAG 1 cut(s) 159
Bst2BI CACGAG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 311
BstBI TTCGAA 1 cut(s) 95
BstC8I GCNNGC 2 cut(s) 485, 565
BstDEI CTNAG 3 cut(s) 350, 498, 629
BstHHI GCGC 2 cut(s) 569, 646
BstKTI GATC 2 cut(s) 76, 266
BstMBI GATC 2 cut(s) 73, 263
BstMWI GCNNNNNNNGC 1 cut(s) 598
BstNI CCWGG 1 cut(s) 311
BstNSI RCATGY 1 cut(s) 487
BstSCI CCNGG 1 cut(s) 309
BstV1I GCAGC 2 cut(s) 477, 604
BstX2I RGATCY 1 cut(s) 73
BstXI CCANNNNNNTGG 1 cut(s) 70
BstYI RGATCY 1 cut(s) 73
BsuRI GGCC 1 cut(s) 206
BtsIMutI CAGTG 2 cut(s) 31, 716
Cac8I GCNNGC 2 cut(s) 485, 565
CfoI GCGC 2 cut(s) 569, 646
Cfr13I GGNCC 1 cut(s) 227
CsiI ACCWGGT 1 cut(s) 309
Csp6I GTAC 1 cut(s) 201
CviAII CATG 4 cut(s) 64, 394, 484, 578
CviJI RGCY 8 cut(s) 59, 135, 206, 244, 411, 468, 502, 691
CviKI_1 RGCY 8 cut(s) 59, 135, 206, 244, 411, 468, 502, 691
CviQI GTAC 1 cut(s) 201
DdeI CTNAG 3 cut(s) 350, 498, 629
DpnI GATC 2 cut(s) 75, 265
DpnII GATC 2 cut(s) 73, 263
DriI GACNNNNNGTC 1 cut(s) 338
Eam1105I GACNNNNNGTC 1 cut(s) 338
Eco47I GGWCC 1 cut(s) 227
EcoRII CCWGG 1 cut(s) 309
FaeI CATG 4 cut(s) 67, 397, 487, 581
FaiI YATR 8 cut(s) 65, 282, 395, 414, 485, 579, 608, 659
FaqI GGGAC 2 cut(s) 317, 370
FatI CATG 4 cut(s) 63, 393, 483, 577
FblI GTMKAC 1 cut(s) 530
Fnu4HI GCNGC 2 cut(s) 466, 593
Fsp4HI GCNGC 2 cut(s) 466, 593
FspBI CTAG 2 cut(s) 224, 261
GlaI GCGC 2 cut(s) 568, 645
GluI GCNGC 2 cut(s) 466, 593
GsuI CTGGAG 1 cut(s) 740
HaeIII GGCC 1 cut(s) 206
HhaI GCGC 2 cut(s) 569, 646
Hin1II CATG 4 cut(s) 67, 397, 487, 581
Hin6I GCGC 2 cut(s) 567, 644
HinP1I GCGC 2 cut(s) 567, 644
HindIII AAGCTT 1 cut(s) 242
HinfI GANTC 4 cut(s) 28, 92, 380, 521
HphI GGTGA 2 cut(s) 122, 614
Hpy166II GTNNAC 1 cut(s) 531
Hpy188I TCNGA 4 cut(s) 321, 351, 379, 423
Hpy188III TCNNGA 4 cut(s) 44, 161, 261, 267
Hpy8I GTNNAC 1 cut(s) 531
HpyAV CCTTC 1 cut(s) 678
HpyCH4IV ACGT 1 cut(s) 527
HpyCH4V TGCA 2 cut(s) 176, 416
HpyF10VI GCNNNNNNNGC 1 cut(s) 598
HpyF3I CTNAG 3 cut(s) 350, 498, 629
HpySE526I ACGT 1 cut(s) 527
Hsp92II CATG 4 cut(s) 67, 397, 487, 581
HspAI GCGC 2 cut(s) 567, 644
Kzo9I GATC 2 cut(s) 73, 263
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 9 cut(s) 19, 29, 174, 296, 323, 351, 379, 397, 704
Lsp1109I GCAGC 2 cut(s) 477, 604
MabI ACCWGGT 1 cut(s) 309
MaeI CTAG 2 cut(s) 224, 261
MaeII ACGT 1 cut(s) 527
MaeIII GTNAC 3 cut(s) 370, 620, 651
MalI GATC 2 cut(s) 75, 265
MboI GATC 2 cut(s) 73, 263
MfeI CAATTG 1 cut(s) 471
MflI RGATCY 1 cut(s) 73
MluCI AATT 4 cut(s) 51, 471, 570, 726
MnlI CCTC 7 cut(s) 187, 263, 293, 636, 673, 681, 715
MslI CAYNNNNRTG 2 cut(s) 68, 582
MspR9I CCNGG 1 cut(s) 311
MunI CAATTG 1 cut(s) 471
MvaI CCWGG 1 cut(s) 311
MwoI GCNNNNNNNGC 1 cut(s) 598
NdeII GATC 2 cut(s) 73, 263
NlaIII CATG 4 cut(s) 67, 397, 487, 581
NmuCI GTSAC 3 cut(s) 370, 620, 651
NspI RCATGY 1 cut(s) 487
NspV TTCGAA 1 cut(s) 95
PaeI GCATGC 1 cut(s) 487
PfeI GAWTC 4 cut(s) 28, 92, 380, 521
PkrI GCNGC 2 cut(s) 467, 594
Psp6I CCWGG 1 cut(s) 309
PspGI CCWGG 1 cut(s) 309
PspPI GGNCC 1 cut(s) 227
PsuI RGATCY 1 cut(s) 73
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
RseI CAYNNNNRTG 2 cut(s) 68, 582
SatI GCNGC 2 cut(s) 466, 593
Sau3AI GATC 2 cut(s) 73, 263
Sau96I GGNCC 1 cut(s) 227
ScrFI CCNGG 1 cut(s) 311
SetI ASST 6 cut(s) 61, 246, 315, 413, 470, 530
SexAI ACCWGGT 1 cut(s) 309
SfuI TTCGAA 1 cut(s) 95
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 2 cut(s) 68, 582
SphI GCATGC 1 cut(s) 487
Sse9I AATT 4 cut(s) 51, 471, 570, 726
SspMI CTAG 2 cut(s) 224, 261
StyD4I CCNGG 1 cut(s) 309
TaiI ACGT 1 cut(s) 530
TaqI TCGA 2 cut(s) 90, 95
TasI AATT 4 cut(s) 51, 471, 570, 726
TfiI GAWTC 4 cut(s) 28, 92, 380, 521
TscAI CASTG 2 cut(s) 38, 723
TseFI GTSAC 3 cut(s) 370, 620, 651
TseI GCWGC 2 cut(s) 465, 592
Tsp45I GTSAC 3 cut(s) 370, 620, 651
TspDTI ATGAA 3 cut(s) 26, 410, 564
TspGWI ACGGA 1 cut(s) 548
TspRI CASTG 2 cut(s) 38, 723
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 1 cut(s) 726
XbaI TCTAGA 1 cut(s) 260
XceI RCATGY 1 cut(s) 487
XcmI CCANNNNNNNNNTGG 1 cut(s) 709
XmiI GTMKAC 1 cut(s) 530
XspI CTAG 2 cut(s) 224, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.