Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014966.1

Orthogroup ID

OG0005739

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1255

Gene Structure 1255 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014966.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 528 bp

atgtatgttgaacaaggcaccggagagaatgataagtgggattctgaatcccaacatatggatctgctttcttcaaaaattaacagatctggaccaattgataattctgatatagttgaaaaagaatccgagggaggtggaggtgatctacagcttcgtagaatgctgatggaagagcttgactatgtcctagtttctcaagaagtttgggaaaagctatttgattggtataaaggaggtccatcattaccaagaaagatgatttctcagggcggcattaataagaatttgatggtggaggtttacccattgtgtcttaagattgttgattctagagacaacagccaggcagttatctggttaagcaaaaaggcttctgtccaggagctttacgagaaggtgtgcacaattagaggaattgagcaacaaaaggcctgtatctgggattacttcaacaagcagaagcagtcattattgaatgcttcgaaccaaacgttggagcagttgaacttgcagatggatcaagat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04137 map04137

Pfam Domains

Protein Families

DUSP UCH

Protein Analysis

176

Amino Acids

20.24

Weight (kDa)

4.79

Isoelectric Point (pI)

60.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005739)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G32850 AT4G10570 AT4G10590 AT4G10590 AT4G10590 AT4G10590
fragaria_vesca	FvH4_5g10610 FvH4_5g10610 FvH4_5g10610
malus_domestica	MD06G1121900.v1.1 MD14G1138300.v1.1
prunus_persica	Prupe.5G132600_v2.0.a1 Prupe.5G132600_v2.0.a1 Prupe.5G132600_v2.0.a1
pyrus_communis	pycom06g11300 pycom14g11340
rosa_chinensis	RchiOBHm_Chr7g0187531
rosa_laevigata	RLG00000004773
rosa_multiflora	Rmu_sc0008640.1_g000004 Rmu_sc0014966.1_g000001 Rmu_sc0023622.1_g000001 Rmu_ssc0000110.1_g000024
rosa_roxburghii	Rroxscaffold_3G00267350
rosa_rugosa	Rorug06G0482500
rosa_samantha	Rh7AG087100 Rh7BG088500 Rh7CG087800 Rh7DG089400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	17
AccB7I	CCANNNNNTGG	2 cut(s)	58, 496
AciI	CCGC	1 cut(s)	273
AclI	AACGTT	1 cut(s)	494
AclWI	GGATC	1 cut(s)	69
AcsI	RAATTY	1 cut(s)	286
AfiI	CCNNNNNNNGG	3 cut(s)	58, 441, 496
AflII	CTTAAG	1 cut(s)	317
AgsI	TTSAA	6 cut(s)	11, 75, 119, 454, 478, 508
AjnI	CCWGG	2 cut(s)	345, 381
AjuI	GAANNNNNNNTTGG	4 cut(s)	88, 120, 479, 511
AluBI	AGCT	4 cut(s)	154, 178, 217, 388
AluI	AGCT	4 cut(s)	154, 178, 217, 388
Alw21I	GWGCWC	1 cut(s)	407
Alw26I	GTCTC	1 cut(s)	330
Alw44I	GTGCAC	1 cut(s)	403
AlwI	GGATC	1 cut(s)	69
AoxI	GGCC	1 cut(s)	432
ApaLI	GTGCAC	1 cut(s)	403
ApoI	RAATTY	1 cut(s)	286
AseI	ATTAAT	1 cut(s)	279
AspS9I	GGNCC	2 cut(s)	92, 239
AsuHPI	GGTGA	1 cut(s)	155
AsuII	TTCGAA	1 cut(s)	485
AvaII	GGWCC	2 cut(s)	92, 239
BaeGI	GKGCMC	1 cut(s)	407
BanI	GGYRCC	1 cut(s)	17
Bbv12I	GWGCWC	1 cut(s)	407
BccI	CCATC	4 cut(s)	163, 250, 286, 511
BciT130I	CCWGG	2 cut(s)	347, 383
BcoDI	GTCTC	1 cut(s)	330
BfaI	CTAG	2 cut(s)	191, 333
BfmI	CTRYAG	1 cut(s)	149
BfrI	CTTAAG	1 cut(s)	317
BglII	AGATCT	1 cut(s)	86
BisI	GCNGC	1 cut(s)	274
BlsI	GCNGC	1 cut(s)	275
Bme1390I	CCNGG	2 cut(s)	347, 383
Bme18I	GGWCC	2 cut(s)	92, 239
BmgT120I	GGNCC	2 cut(s)	92, 239
BmiI	GGNNCC	1 cut(s)	19
BmrFI	CCNGG	2 cut(s)	347, 383
Bpu14I	TTCGAA	1 cut(s)	485
BpuEI	CTTGAG	1 cut(s)	183
BsaJI	CCNNGG	1 cut(s)	129
BsaWI	WCCGGW	1 cut(s)	20
Bsc4I	CCNNNNNNNGG	3 cut(s)	58, 441, 496
BseBI	CCWGG	2 cut(s)	347, 383
BseDI	CCNNGG	1 cut(s)	129
BseLI	CCNNNNNNNGG	3 cut(s)	58, 441, 496
BseMII	CTCAG	1 cut(s)	281
BseSI	GKGCMC	1 cut(s)	407
BshFI	GGCC	1 cut(s)	434
BshNI	GGYRCC	1 cut(s)	17
BsiHKAI	GWGCWC	1 cut(s)	407
BsiSI	CCGG	1 cut(s)	21
BslI	CCNNNNNNNGG	3 cut(s)	58, 441, 496
BsmAI	GTCTC	1 cut(s)	330
BsmI	GAATGC	2 cut(s)	168, 484
BsnI	GGCC	1 cut(s)	434
Bsp119I	TTCGAA	1 cut(s)	485
Bsp1286I	GDGCHC	1 cut(s)	407
Bsp143I	GATC	4 cut(s)	61, 86, 145, 520
BspACI	CCGC	1 cut(s)	273
BspANI	GGCC	1 cut(s)	434
BspCNI	CTCAG	1 cut(s)	280
BspLI	GGNNCC	1 cut(s)	19
BspPI	GGATC	1 cut(s)	69
BspQI	GCTCTTC	1 cut(s)	168
BspT104I	TTCGAA	1 cut(s)	485
BspT107I	GGYRCC	1 cut(s)	17
BspTI	CTTAAG	1 cut(s)	317
BssECI	CCNNGG	1 cut(s)	129
BssMI	GATC	4 cut(s)	61, 86, 145, 520
Bst2UI	CCWGG	2 cut(s)	347, 383
Bst6I	CTCTTC	1 cut(s)	168
BstAFI	CTTAAG	1 cut(s)	317
BstBI	TTCGAA	1 cut(s)	485
BstDEI	CTNAG	1 cut(s)	267
BstKTI	GATC	4 cut(s)	64, 89, 148, 523
BstMAI	GTCTC	1 cut(s)	330
BstMBI	GATC	4 cut(s)	61, 86, 145, 520
BstNI	CCWGG	2 cut(s)	347, 383
BstSCI	CCNGG	2 cut(s)	345, 381
BstSFI	CTRYAG	1 cut(s)	149
BstSLI	GKGCMC	1 cut(s)	407
BstX2I	RGATCY	2 cut(s)	61, 86
BstYI	RGATCY	2 cut(s)	61, 86
BsuRI	GGCC	1 cut(s)	434
Cfr13I	GGNCC	2 cut(s)	92, 239
CviJI	RGCY	7 cut(s)	154, 178, 217, 345, 374, 388, 434
CviKI_1	RGCY	7 cut(s)	154, 178, 217, 345, 374, 388, 434
DdeI	CTNAG	1 cut(s)	267
DpnI	GATC	4 cut(s)	63, 88, 147, 522
DpnII	GATC	4 cut(s)	61, 86, 145, 520
Eam1104I	CTCTTC	1 cut(s)	168
EarI	CTCTTC	1 cut(s)	168
Eco147I	AGGCCT	1 cut(s)	434
Eco47I	GGWCC	2 cut(s)	92, 239
EcoRII	CCWGG	2 cut(s)	345, 381
FaiI	YATR	6 cut(s)	6, 57, 59, 113, 186, 231
FauNDI	CATATG	1 cut(s)	57
Fnu4HI	GCNGC	1 cut(s)	274
Fsp4HI	GCNGC	1 cut(s)	274
FspBI	CTAG	2 cut(s)	191, 333
GluI	GCNGC	1 cut(s)	274
HaeIII	GGCC	1 cut(s)	434
HapII	CCGG	1 cut(s)	21
HinfI	GANTC	4 cut(s)	41, 47, 125, 329
HpaII	CCGG	1 cut(s)	21
HphI	GGTGA	1 cut(s)	155
Hpy166II	GTNNAC	2 cut(s)	304, 405
Hpy188I	TCNGA	3 cut(s)	46, 109, 130
Hpy188III	TCNNGA	4 cut(s)	90, 200, 333, 524
Hpy8I	GTNNAC	2 cut(s)	304, 405
HpyAV	CCTTC	1 cut(s)	391
HpyCH4IV	ACGT	1 cut(s)	494
HpyCH4V	TGCA	2 cut(s)	405, 514
HpyF3I	CTNAG	1 cut(s)	267
HpySE526I	ACGT	1 cut(s)	494
Kzo9I	GATC	4 cut(s)	61, 86, 145, 520
LguI	GCTCTTC	1 cut(s)	168
LmnI	GCTCC	2 cut(s)	385, 499
MaeI	CTAG	2 cut(s)	191, 333
MaeII	ACGT	1 cut(s)	494
MalI	GATC	4 cut(s)	63, 88, 147, 522
MboI	GATC	4 cut(s)	61, 86, 145, 520
MboII	GAAGA	2 cut(s)	63, 185
MfeI	CAATTG	1 cut(s)	96
MflI	RGATCY	2 cut(s)	61, 86
MhlI	GDGCHC	1 cut(s)	407
MluCI	AATT	6 cut(s)	78, 96, 103, 286, 408, 417
MmeI	TCCRAC	1 cut(s)	477
MnlI	CCTC	6 cut(s)	124, 128, 134, 230, 292, 407
MseI	TTAA	4 cut(s)	81, 279, 318, 362
MspCI	CTTAAG	1 cut(s)	317
MspI	CCGG	1 cut(s)	21
MspR9I	CCNGG	2 cut(s)	347, 383
MunI	CAATTG	1 cut(s)	96
Mva1269I	GAATGC	2 cut(s)	168, 484
MvaI	CCWGG	2 cut(s)	347, 383
NdeI	CATATG	1 cut(s)	57
NdeII	GATC	4 cut(s)	61, 86, 145, 520
NlaIV	GGNNCC	1 cut(s)	19
NspV	TTCGAA	1 cut(s)	485
PceI	AGGCCT	1 cut(s)	434
PciSI	GCTCTTC	1 cut(s)	168
PcsI	WCGNNNNNNNCGW	1 cut(s)	491
PctI	GAATGC	2 cut(s)	168, 484
PfeI	GAWTC	4 cut(s)	41, 47, 125, 329
PflFI	GACNNNGTC	1 cut(s)	185
PflMI	CCANNNNNTGG	2 cut(s)	58, 496
PfoI	TCCNGGA	1 cut(s)	381
PkrI	GCNGC	1 cut(s)	275
PshBI	ATTAAT	1 cut(s)	279
Psp1406I	AACGTT	1 cut(s)	494
Psp6I	CCWGG	2 cut(s)	345, 381
PspGI	CCWGG	2 cut(s)	345, 381
PspN4I	GGNNCC	1 cut(s)	19
PspPI	GGNCC	2 cut(s)	92, 239
PsuI	RGATCY	2 cut(s)	61, 86
PsyI	GACNNNGTC	1 cut(s)	185
SapI	GCTCTTC	1 cut(s)	168
SaqAI	TTAA	4 cut(s)	81, 279, 318, 362
SatI	GCNGC	1 cut(s)	274
Sau3AI	GATC	4 cut(s)	61, 86, 145, 520
Sau96I	GGNCC	2 cut(s)	92, 239
ScrFI	CCNGG	2 cut(s)	347, 383
SduI	GDGCHC	1 cut(s)	407
SfcI	CTRYAG	1 cut(s)	149
SfuI	TTCGAA	1 cut(s)	485
SinI	GGWCC	2 cut(s)	92, 239
SmlI	CTYRAG	2 cut(s)	198, 317
SmoI	CTYRAG	2 cut(s)	198, 317
Sse9I	AATT	6 cut(s)	78, 96, 103, 286, 408, 417
SseBI	AGGCCT	1 cut(s)	434
SsiI	CCGC	1 cut(s)	273
SspMI	CTAG	2 cut(s)	191, 333
StuI	AGGCCT	1 cut(s)	434
StyD4I	CCNGG	2 cut(s)	345, 381
TaiI	ACGT	1 cut(s)	497
TaqI	TCGA	1 cut(s)	485
TasI	AATT	6 cut(s)	78, 96, 103, 286, 408, 417
TauI	GCSGC	1 cut(s)	276
TfiI	GAWTC	4 cut(s)	41, 47, 125, 329
Tru1I	TTAA	4 cut(s)	81, 279, 318, 362
Tru9I	TTAA	4 cut(s)	81, 279, 318, 362
Tth111I	GACNNNGTC	1 cut(s)	185
Van91I	CCANNNNNTGG	2 cut(s)	58, 496
Vha464I	CTTAAG	1 cut(s)	317
VneI	GTGCAC	1 cut(s)	403
VpaK11BI	GGWCC	2 cut(s)	92, 239
VspI	ATTAAT	1 cut(s)	279
XapI	RAATTY	1 cut(s)	286
XbaI	TCTAGA	1 cut(s)	332
XspI	CTAG	2 cut(s)	191, 333

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.