Rmu_sc0016103.1_g000006

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016103.1
Physical Location & Seq
Forward (+)
24282 .. 24733
452 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016103.1_g000006.1.cds

Sequence Viewer

Length: 336 bp
atgaagcttggtgcagaagaacctgttgaagtgaagagaagtaaggcaaagctgcattcgcttgtggatgaagcaggtggtttggaccaaattttggttaaacataaatcaagacttgagaaagaaaagggggctgctgctcagcaaccagaggaccggactagattctctgtgactcgaaaacaagcaagggagagagaactacaagaacaatggggaggtctaggcttaggaaactccatgaagccacatcaatcgaaacttgaactggataaggctgcttggattaaagctggacaagaggaaaagaggcaagctgtgggattctcaggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.39

Weight (kDa)

9.6

Isoelectric Point (pI)

47.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 65
Acc36I ACCTGC 1 cut(s) 65
AccB7I CCANNNNNTGG 1 cut(s) 94
AcsI RAATTY 1 cut(s) 90
AfiI CCNNNNNNNGG 1 cut(s) 94
AgsI TTSAA 2 cut(s) 29, 266
AluBI AGCT 4 cut(s) 7, 52, 293, 317
AluI AGCT 4 cut(s) 7, 52, 293, 317
ApeKI GCWGC 4 cut(s) 52, 134, 137, 278
ApoI RAATTY 1 cut(s) 90
AspS9I GGNCC 2 cut(s) 85, 154
AvaII GGWCC 2 cut(s) 85, 154
BbvI GCAGC 4 cut(s) 39, 121, 124, 265
BfaI CTAG 2 cut(s) 162, 224
BfuAI ACCTGC 1 cut(s) 65
BisI GCNGC 4 cut(s) 53, 135, 138, 279
BlpI GCTNAGC 1 cut(s) 141
BlsI GCNGC 4 cut(s) 54, 136, 139, 280
Bme18I GGWCC 2 cut(s) 85, 154
BmgT120I GGNCC 2 cut(s) 85, 154
Bpu10I CCTNAGC 1 cut(s) 229
Bpu1102I GCTNAGC 1 cut(s) 141
BpuEI CTTGAG 1 cut(s) 137
BsaWI WCCGGW 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 94
Bse1I ACTGG 1 cut(s) 273
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 155
BseNI ACTGG 1 cut(s) 273
BseXI GCAGC 4 cut(s) 39, 121, 124, 265
BsgI GTGCAG 1 cut(s) 33
BsiSI CCGG 1 cut(s) 157
BslI CCNNNNNNNGG 1 cut(s) 94
BsmI GAATGC 1 cut(s) 55
Bsp1720I GCTNAGC 1 cut(s) 141
BspCNI CTCAG 1 cut(s) 154
BspMI ACCTGC 1 cut(s) 65
BsrI ACTGG 1 cut(s) 273
Bst6I CTCTTC 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 315
BstDEI CTNAG 3 cut(s) 141, 229, 328
BstF5I GGATG 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstV1I GCAGC 4 cut(s) 39, 121, 124, 265
BtsCI GGATG 1 cut(s) 73
BveI ACCTGC 1 cut(s) 65
Cac8I GCNNGC 1 cut(s) 315
Cfr13I GGNCC 2 cut(s) 85, 154
CviAII CATG 1 cut(s) 241
CviJI RGCY 8 cut(s) 7, 52, 134, 228, 247, 278, 293, 317
CviKI_1 RGCY 8 cut(s) 7, 52, 134, 228, 247, 278, 293, 317
DdeI CTNAG 3 cut(s) 141, 229, 328
Eam1104I CTCTTC 1 cut(s) 29
EarI CTCTTC 1 cut(s) 29
Eco47I GGWCC 2 cut(s) 85, 154
FaeI CATG 1 cut(s) 244
FaiI YATR 2 cut(s) 105, 242
FatI CATG 1 cut(s) 240
Fnu4HI GCNGC 4 cut(s) 53, 135, 138, 279
FokI GGATG 1 cut(s) 80
Fsp4HI GCNGC 4 cut(s) 53, 135, 138, 279
FspBI CTAG 2 cut(s) 162, 224
GluI GCNGC 4 cut(s) 53, 135, 138, 279
HapII CCGG 1 cut(s) 157
Hin1II CATG 1 cut(s) 244
HindIII AAGCTT 1 cut(s) 5
HinfI GANTC 3 cut(s) 165, 175, 324
HpaII CCGG 1 cut(s) 157
Hpy188III TCNNGA 1 cut(s) 111
HpyCH4V TGCA 2 cut(s) 14, 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
HpyF3I CTNAG 3 cut(s) 141, 229, 328
Hsp92II CATG 1 cut(s) 244
LpnPI CCDG 7 cut(s) 36, 60, 162, 170, 254, 279, 315
Lsp1109I GCAGC 4 cut(s) 39, 121, 124, 265
MaeI CTAG 2 cut(s) 162, 224
MaeIII GTNAC 1 cut(s) 172
MboII GAAGA 2 cut(s) 29, 46
MluCI AATT 1 cut(s) 90
MlyI GAGTC 1 cut(s) 169
MnlI CCTC 4 cut(s) 145, 212, 295, 303
MseI TTAA 3 cut(s) 99, 288, 334
MspI CCGG 1 cut(s) 157
Mva1269I GAATGC 1 cut(s) 55
MwoI GCNNNNNNNGC 1 cut(s) 58
NlaIII CATG 1 cut(s) 244
NmuCI GTSAC 1 cut(s) 172
PaqCI CACCTGC 1 cut(s) 65
PctI GAATGC 1 cut(s) 55
PfeI GAWTC 2 cut(s) 165, 324
PflMI CCANNNNNTGG 1 cut(s) 94
PkrI GCNGC 4 cut(s) 54, 136, 139, 280
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PspPI GGNCC 2 cut(s) 85, 154
SaqAI TTAA 3 cut(s) 99, 288, 334
SatI GCNGC 4 cut(s) 53, 135, 138, 279
Sau96I GGNCC 2 cut(s) 85, 154
SchI GAGTC 1 cut(s) 169
SetI ASST 8 cut(s) 9, 25, 54, 79, 223, 295, 319, 334
SinI GGWCC 2 cut(s) 85, 154
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 1 cut(s) 90
SspMI CTAG 2 cut(s) 162, 224
TaqI TCGA 2 cut(s) 178, 257
TasI AATT 1 cut(s) 90
TfiI GAWTC 2 cut(s) 165, 324
Tru1I TTAA 3 cut(s) 99, 288, 334
Tru9I TTAA 3 cut(s) 99, 288, 334
TseFI GTSAC 1 cut(s) 172
TseI GCWGC 4 cut(s) 52, 134, 137, 278
Tsp45I GTSAC 1 cut(s) 172
TspDTI ATGAA 3 cut(s) 17, 84, 257
Van91I CCANNNNNTGG 1 cut(s) 94
VpaK11BI GGWCC 2 cut(s) 85, 154
XapI RAATTY 1 cut(s) 90
XspI CTAG 2 cut(s) 162, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.