Rmu_sc0017427.1_g000001

peptidyl-tRNA hydrolase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017427.1
Physical Location & Seq
Forward (+)
1 .. 377
377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017427.1_g000001.1.cds

Sequence Viewer

Length: 183 bp
gttactcttgaggtgaagggagaacctcaaatattgaacttgtctgagaagctcaaagctggtggcatagagcacaaactgtggattgagcaacctgagaatttcccaacttgtctcgctacgaaaccttaccccaaatccatggtatcttcgtattttaaaaagttgaagctctgtaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.83

Weight (kDa)

9.23

Isoelectric Point (pI)

46.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010251)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 100
AgsI TTSAA 2 cut(s) 37, 169
AluBI AGCT 3 cut(s) 52, 59, 172
AluI AGCT 3 cut(s) 52, 59, 172
Alw21I GWGCWC 1 cut(s) 75
Alw26I GTCTC 1 cut(s) 119
ApoI RAATTY 1 cut(s) 100
AsuHPI GGTGA 1 cut(s) 25
Bbv12I GWGCWC 1 cut(s) 75
BcoDI GTCTC 1 cut(s) 119
BpuEI CTTGAG 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 141
BseDI CCNNGG 1 cut(s) 141
BseMII CTCAG 2 cut(s) 36, 87
BsiHKAI GWGCWC 1 cut(s) 75
BsmAI GTCTC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 75
Bsp19I CCATGG 1 cut(s) 141
BspCNI CTCAG 2 cut(s) 37, 88
BssECI CCNNGG 1 cut(s) 141
BssT1I CCWWGG 1 cut(s) 141
Bst4CI ACNGT 1 cut(s) 81
BstDEI CTNAG 2 cut(s) 45, 96
BstDSI CCRYGG 1 cut(s) 141
BstMAI GTCTC 1 cut(s) 119
BstXI CCANNNNNNTGG 1 cut(s) 142
BtgI CCRYGG 1 cut(s) 141
CspCI CAANNNNNGTGG 2 cut(s) 43, 78
CviAII CATG 1 cut(s) 142
CviJI RGCY 3 cut(s) 52, 59, 172
CviKI_1 RGCY 3 cut(s) 52, 59, 172
DdeI CTNAG 2 cut(s) 45, 96
DraI TTTAAA 1 cut(s) 160
Eco130I CCWWGG 1 cut(s) 141
EcoT14I CCWWGG 1 cut(s) 141
ErhI CCWWGG 1 cut(s) 141
FaeI CATG 1 cut(s) 145
FaiI YATR 2 cut(s) 68, 143
FatI CATG 1 cut(s) 141
Hin1II CATG 1 cut(s) 145
HphI GGTGA 1 cut(s) 25
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 10
HpyCH4III ACNGT 1 cut(s) 81
HpyF3I CTNAG 2 cut(s) 45, 96
Hsp92II CATG 1 cut(s) 145
LpnPI CCDG 2 cut(s) 45, 108
MboII GAAGA 1 cut(s) 141
MhlI GDGCHC 1 cut(s) 75
MluCI AATT 1 cut(s) 100
MnlI CCTC 2 cut(s) 4, 36
MseI TTAA 1 cut(s) 159
NcoI CCATGG 1 cut(s) 141
NlaIII CATG 1 cut(s) 145
SaqAI TTAA 1 cut(s) 159
SduI GDGCHC 1 cut(s) 75
SetI ASST 7 cut(s) 15, 28, 54, 61, 97, 130, 174
SgeI CNNG 7 cut(s) 20, 52, 72, 107, 123, 128, 154
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
Sse9I AATT 1 cut(s) 100
SspI AATATT 1 cut(s) 33
StyI CCWWGG 1 cut(s) 141
TaaI ACNGT 1 cut(s) 81
TasI AATT 1 cut(s) 100
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
XapI RAATTY 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.