Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017976.1

Orthogroup ID

OG0006343

Physical Location & Seq

Genomic Coordinates Reverse (-)

2299 .. 2722

Gene Structure 424 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017976.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atgaaccaaacagaccaaaccccccataccaaaggagctacatttggctcaaaacagggagttgatcagaaaagctttgacggagtgaaggagaagtatgaaggggaggagtactatagagggcttatgagtaggcttgggtcaatcccaccaaactgtgctcacagatgtgagggttgtgtcccttgtgttccagttcagatgcccacgaccactgaccacattggagttcaatatgccaattatgagcctgaaggatggaaatgcaagtgtggttctactttctttaatccataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

EPF

Protein Analysis

98

Amino Acids

10.9

Weight (kDa)

6.26

Isoelectric Point (pI)

36.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006343)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G13898
fragaria_vesca	FvH4_1g07850 FvH4_6g33980
malus_domestica	MD09G1190400.v1.1
prunus_persica	Prupe.3G046300_v2.0.a1 Prupe.3G046300_v2.0.a1 Prupe.3G046300_v2.0.a1 Prupe.3G046300_v2.0.a1 Prupe.3G046300_v2.0.a1 Prupe.3G046300_v2.0.a1 Prupe.7G206500_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0093721 RchiOBHm_Chr2g0143991
rosa_laevigata	RLG00000016432 RLG00000020066
rosa_multiflora	Rmu_sc0017976.1_g000002
rosa_roxburghii	Rroxscaffold_2G00147850
rosa_rugosa	Rorug02G0385100
rosa_samantha	Rh2AG085800 Rh2AG437800 Rh2BG086000 Rh2BG446300 Rh2CG088400 Rh2CG424400 Rh2DG084000 Rh2DG456500
rosa_wichuraiana	Rw2G035750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	273
AfaI	GTAC	1 cut(s)	113
AgsI	TTSAA	1 cut(s)	233
AleI	CACNNNNGTG	1 cut(s)	168
AluBI	AGCT	2 cut(s)	38, 75
AluI	AGCT	2 cut(s)	38, 75
Alw21I	GWGCWC	1 cut(s)	163
Bbv12I	GWGCWC	1 cut(s)	163
BccI	CCATC	1 cut(s)	252
BclI	TGATCA	1 cut(s)	64
BfmI	CTRYAG	1 cut(s)	115
BmcAI	AGTACT	1 cut(s)	113
BmsI	GCATC	1 cut(s)	192
Bse1I	ACTGG	1 cut(s)	194
BseGI	GGATG	1 cut(s)	263
BseNI	ACTGG	1 cut(s)	194
BseRI	GAGGAG	1 cut(s)	122
BsiHKAI	GWGCWC	1 cut(s)	163
BslFI	GGGAC	1 cut(s)	167
BsmFI	GGGAC	1 cut(s)	167
Bsp1286I	GDGCHC	1 cut(s)	163
Bsp143I	GATC	1 cut(s)	64
BsrI	ACTGG	1 cut(s)	194
BssMI	GATC	1 cut(s)	64
Bst4CI	ACNGT	1 cut(s)	158
BstF5I	GGATG	1 cut(s)	263
BstKTI	GATC	1 cut(s)	67
BstMBI	GATC	1 cut(s)	64
BstSFI	CTRYAG	1 cut(s)	115
BtsCI	GGATG	1 cut(s)	263
BtsIMutI	CAGTG	1 cut(s)	213
Csp6I	GTAC	1 cut(s)	112
CviJI	RGCY	6 cut(s)	38, 48, 75, 124, 136, 250
CviKI_1	RGCY	6 cut(s)	38, 48, 75, 124, 136, 250
CviQI	GTAC	1 cut(s)	112
DpnI	GATC	1 cut(s)	66
DpnII	GATC	1 cut(s)	64
Eco57I	CTGAAG	1 cut(s)	273
FaiI	YATR	7 cut(s)	27, 99, 117, 128, 237, 246, 295
FaqI	GGGAC	1 cut(s)	167
FbaI	TGATCA	1 cut(s)	64
FokI	GGATG	1 cut(s)	270
HindIII	AAGCTT	1 cut(s)	73
Hpy188I	TCNGA	2 cut(s)	69, 201
HpyAV	CCTTC	3 cut(s)	82, 95, 248
HpyCH4III	ACNGT	1 cut(s)	158
HpyCH4V	TGCA	1 cut(s)	267
Ksp22I	TGATCA	1 cut(s)	64
Kzo9I	GATC	1 cut(s)	64
LmnI	GCTCC	1 cut(s)	35
LpnPI	CCDG	3 cut(s)	41, 207, 264
LweI	GCATC	1 cut(s)	192
MalI	GATC	1 cut(s)	66
MboI	GATC	1 cut(s)	64
MhlI	GDGCHC	1 cut(s)	163
MluCI	AATT	1 cut(s)	241
MnlI	CCTC	3 cut(s)	100, 113, 166
MseI	TTAA	1 cut(s)	288
MslI	CAYNNNNRTG	1 cut(s)	168
NdeII	GATC	1 cut(s)	64
OliI	CACNNNNGTG	1 cut(s)	168
RsaI	GTAC	1 cut(s)	113
RsaNI	GTAC	1 cut(s)	112
RseI	CAYNNNNRTG	1 cut(s)	168
SaqAI	TTAA	1 cut(s)	288
Sau3AI	GATC	1 cut(s)	64
ScaI	AGTACT	1 cut(s)	113
SduI	GDGCHC	1 cut(s)	163
SetI	ASST	2 cut(s)	40, 77
SfaNI	GCATC	1 cut(s)	192
SfcI	CTRYAG	1 cut(s)	115
SgeI	CNNG	7 cut(s)	68, 149, 198, 206, 220, 263, 280
SmiMI	CAYNNNNRTG	1 cut(s)	168
Sse9I	AATT	1 cut(s)	241
TaaI	ACNGT	1 cut(s)	158
TasI	AATT	1 cut(s)	241
TatI	WGTACW	1 cut(s)	111
Tru1I	TTAA	1 cut(s)	288
Tru9I	TTAA	1 cut(s)	288
TscAI	CASTG	1 cut(s)	220
TspDTI	ATGAA	2 cut(s)	17, 114
TspGWI	ACGGA	1 cut(s)	96
TspRI	CASTG	1 cut(s)	220
ZrmI	AGTACT	1 cut(s)	113

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.