Rroxscaffold_2G00147850

Epidermal patterning factor proteins

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
85533611 .. 85534215
605 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00147850.1

Sequence Viewer

Length: 171 bp
ATGAGTAGGCTTGGGTCAATCCCACCAAACTGTGCTCACAGATGTGAAGGTTGTGTCCCTTGTGTTCCAGTTCAGATACCCACGACCACTGACCACATTGGAGTTCAATATGCCAATTATGAGCCTGAAGGATGGAAATGCAAGTGTGGTTCTACTTTCTTTAATCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.14

Weight (kDa)

6.68

Isoelectric Point (pI)

47.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EPF PF17181 3 - 56 4.4e-21 Epidermal patterning factor proteins
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 147
AgsI TTSAA 1 cut(s) 107
AleI CACNNNNGTG 1 cut(s) 42
Alw21I GWGCWC 1 cut(s) 37
Bbv12I GWGCWC 1 cut(s) 37
BccI CCATC 1 cut(s) 126
Bse1I ACTGG 1 cut(s) 68
BseGI GGATG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 68
BsiHKAI GWGCWC 1 cut(s) 37
BslFI GGGAC 1 cut(s) 41
BsmFI GGGAC 1 cut(s) 41
Bsp1286I GDGCHC 1 cut(s) 37
BsrI ACTGG 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 32
BstF5I GGATG 1 cut(s) 137
BtsCI GGATG 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 87
CviJI RGCY 2 cut(s) 10, 124
CviKI_1 RGCY 2 cut(s) 10, 124
Eco57I CTGAAG 1 cut(s) 147
FaiI YATR 3 cut(s) 111, 120, 169
FaqI GGGAC 1 cut(s) 41
FokI GGATG 1 cut(s) 144
Hpy188I TCNGA 1 cut(s) 75
HpyAV CCTTC 2 cut(s) 41, 122
HpyCH4III ACNGT 1 cut(s) 32
HpyCH4V TGCA 1 cut(s) 141
LpnPI CCDG 2 cut(s) 81, 138
MhlI GDGCHC 1 cut(s) 37
MluCI AATT 1 cut(s) 115
MseI TTAA 1 cut(s) 162
MslI CAYNNNNRTG 1 cut(s) 42
OliI CACNNNNGTG 1 cut(s) 42
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 1 cut(s) 162
SduI GDGCHC 1 cut(s) 37
SetI ASST 1 cut(s) 52
SgeI CNNG 6 cut(s) 23, 72, 80, 94, 137, 154
SmiMI CAYNNNNRTG 1 cut(s) 42
Sse9I AATT 1 cut(s) 115
TaaI ACNGT 1 cut(s) 32
TasI AATT 1 cut(s) 115
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TscAI CASTG 1 cut(s) 94
TspRI CASTG 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.