Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0018303.1

Orthogroup ID

OG0006788

Physical Location & Seq

Genomic Coordinates Forward (+)

5627 .. 10167

Gene Structure 4541 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0018303.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1176 bp

atggaatttgaagaaggaaaaagcaatggtgatagcatggagttcactagggcggctcgatgctccaagaatgaagccaatggttttgaatttgcgatatgtaatgatgttgccaagagcagctcctcaggggcaagtgagggtattcggacttacaagaggcggaggcgtgagaggtggagttgggatagcaaatcacaggaagatgggagagctaatggggaatcttggagtcaaatggtggaccagttccacaccttggaatctgactcttatcctaaactggagcagacagaggattgtggtgtatacacagtatacacttgcaggcactgtggagacaaggcaaatgggagtgattgtctagtatgtgattcatgtgaggagatgtaccatgtatcttgcattcagcctgctgtcaaaggcattcctacaaaaagttggtattgtgcaagttgcactgcttgtggtattgcatcaccgcatgagaattgtgaagtgtgtgaaaggctgattgccagcaaaagtctagttgatggagttggcggtgaaaatgttcctacaaatgaggaaacagtcgagttgggagataactcaaattatagtacagacgatggaattcaactatctgaagataatggcgacttgaacctttgcaaagtttgtggagttgtggtagtaaagggtgagacggtgaaaatatgtggtcatccatactgcatgaacaagtactaccatgtgaggtgtctgacggcagggcagttgaagctgtatggtccacgttggtactgcccttcttgtctatgcagagcttgtctcaccgataaagatgatgataagattgttctttgtgatggctgcgatcatgcgtaccatatctattgcttgaacccaccactctgttccattccaaaaggaaaatggttttgcagaaaatgtgatgcaacaattcagatgatacgcagagcaaaaagggcttatcaaaaaaatgaaaagcaacaggataagaaaagtgaaggatcaattaagtggaatgaaaaagttgatgatggagaatcagaacaaggtagggggggaatggatgtgcttctgcatgcagtcaagactctagatcatgaaaagaaaatggctgctactgagataatgagaaactttcaggacagacagaatttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PHD

Protein Analysis

391

Amino Acids

43.88

Weight (kDa)

5.68

Isoelectric Point (pI)

47.69

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006788)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G77250
fragaria_vesca	FvH4_2g28030 FvH4_2g28030
malus_domestica	MD08G1160700.v1.1 MD15G1132400.v1.1
prunus_persica	Prupe.1G487600_v2.0.a1 Prupe.1G487600_v2.0.a1 Prupe.1G487600_v2.0.a1 Prupe.1G487600_v2.0.a1 Prupe.1G487600_v2.0.a1 Prupe.1G487600_v2.0.a1
pyrus_communis	pycom08g13450 pycom15g11950
rosa_chinensis	RchiOBHm_Chr6g0296911
rosa_laevigata	RLG00000011647
rosa_multiflora	Rmu_co8128438.1_g000001 Rmu_sc0007272.1_g000001 Rmu_sc0018303.1_g000003
rosa_roxburghii	Rroxscaffold_7G00171040
rosa_rugosa	Rorug06G0267500 Rorug06G0267600
rosa_samantha	Rh6AG378200 Rh6BG386200 Rh6CG391600 Rh6DG378900
rosa_wichuraiana	Rw6G033060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	259
AccI	GTMKAC	2 cut(s)	309, 318
AciI	CCGC	4 cut(s)	53, 163, 482, 546
AclWI	GGATC	1 cut(s)	1027
AcsI	RAATTY	4 cut(s)	5, 89, 618, 1168
AcuI	CTGAAG	1 cut(s)	651
AfaI	GTAC	5 cut(s)	392, 607, 731, 788, 872
AfiI	CCNNNNNNNGG	1 cut(s)	259
AgsI	TTSAA	6 cut(s)	11, 89, 623, 649, 766, 889
AluBI	AGCT	4 cut(s)	123, 215, 769, 812
AluI	AGCT	4 cut(s)	123, 215, 769, 812
Alw26I	GTCTC	3 cut(s)	333, 683, 821
AlwI	GGATC	1 cut(s)	1027
AlwNI	CAGNNNCTG	1 cut(s)	333
ApeKI	GCWGC	3 cut(s)	120, 858, 1130
ApoI	RAATTY	4 cut(s)	5, 89, 618, 1168
Asp700I	GAANNNNTTC	1 cut(s)	555
AspS9I	GGNCC	2 cut(s)	244, 776
AsuHPI	GGTGA	6 cut(s)	41, 471, 560, 698, 706, 811
AvaII	GGWCC	2 cut(s)	244, 776
AxyI	CCTNAGG	1 cut(s)	127
BbvI	GCAGC	3 cut(s)	132, 845, 1117
BccI	CCATC	5 cut(s)	200, 530, 608, 848, 1043
BceAI	ACGGC	1 cut(s)	768
BcoDI	GTCTC	3 cut(s)	333, 683, 821
BfaI	CTAG	4 cut(s)	48, 365, 530, 1109
BisI	GCNGC	4 cut(s)	54, 121, 859, 1131
BlsI	GCNGC	4 cut(s)	55, 122, 860, 1132
BmcAI	AGTACT	1 cut(s)	731
Bme18I	GGWCC	2 cut(s)	244, 776
BmgT120I	GGNCC	2 cut(s)	244, 776
BmsI	GCATC	3 cut(s)	50, 485, 931
BplI	GAGNNNNNCTC	2 cut(s)	801, 833
BpmI	CTGGAG	1 cut(s)	305
BsaJI	CCNNGG	1 cut(s)	258
BsaXI	ACNNNNNCTCC	4 cut(s)	346, 376, 660, 690
Bsc4I	CCNNNNNNNGG	1 cut(s)	259
Bse1I	ACTGG	2 cut(s)	247, 288
Bse21I	CCTNAGG	1 cut(s)	127
Bse3DI	GCAATG	1 cut(s)	31
BseDI	CCNNGG	1 cut(s)	258
BseGI	GGATG	2 cut(s)	709, 1087
BseLI	CCNNNNNNNGG	1 cut(s)	259
BseMI	GCAATG	1 cut(s)	31
BseMII	CTCAG	2 cut(s)	141, 1128
BseNI	ACTGG	2 cut(s)	247, 288
BseRI	GAGGAG	2 cut(s)	115, 398
BseXI	GCAGC	3 cut(s)	132, 845, 1117
BslI	CCNNNNNNNGG	1 cut(s)	259
BsmAI	GTCTC	3 cut(s)	333, 683, 821
BsmBI	CGTCTC	1 cut(s)	683
BsmI	GAATGC	2 cut(s)	405, 426
Bsp143I	GATC	3 cut(s)	862, 1019, 1111
BspACI	CCGC	4 cut(s)	53, 163, 482, 546
BspCNI	CTCAG	2 cut(s)	140, 1129
BspHI	TCATGA	1 cut(s)	1114
BspPI	GGATC	1 cut(s)	1027
BsrDI	GCAATG	1 cut(s)	31
BsrI	ACTGG	2 cut(s)	247, 288
BssECI	CCNNGG	1 cut(s)	258
BssMI	GATC	3 cut(s)	862, 1019, 1111
BssNAI	GTATAC	2 cut(s)	310, 319
BssT1I	CCWWGG	1 cut(s)	258
Bst1107I	GTATAC	2 cut(s)	310, 319
Bst4CI	ACNGT	4 cut(s)	316, 335, 577, 694
BstC8I	GCNNGC	4 cut(s)	329, 414, 520, 1095
BstDEI	CTNAG	2 cut(s)	127, 1137
BstF5I	GGATG	2 cut(s)	709, 1087
BstKTI	GATC	3 cut(s)	865, 1022, 1114
BstMAI	GTCTC	3 cut(s)	333, 683, 821
BstMBI	GATC	3 cut(s)	862, 1019, 1111
BstMWI	GCNNNNNNNGC	2 cut(s)	766, 974
BstNSI	RCATGY	1 cut(s)	1097
BstV1I	GCAGC	3 cut(s)	132, 845, 1117
BstZ17I	GTATAC	2 cut(s)	310, 319
Bsu36I	CCTNAGG	1 cut(s)	127
BtsCI	GGATG	2 cut(s)	709, 1087
BtsI	GCAGTG	1 cut(s)	459
BtsIMutI	CAGTG	2 cut(s)	331, 459
Cac8I	GCNNGC	4 cut(s)	329, 414, 520, 1095
CaiI	CAGNNNCTG	1 cut(s)	333
CciI	TCATGA	1 cut(s)	1114
Cfr13I	GGNCC	2 cut(s)	244, 776
Csp6I	GTAC	5 cut(s)	391, 606, 730, 787, 871
CspCI	CAANNNNNGTGG	2 cut(s)	646, 681
CviAII	CATG	9 cut(s)	37, 378, 395, 485, 721, 737, 866, 1094, 1115
CviQI	GTAC	5 cut(s)	391, 606, 730, 787, 871
DdeI	CTNAG	2 cut(s)	127, 1137
DpnI	GATC	3 cut(s)	864, 1021, 1113
DpnII	GATC	3 cut(s)	862, 1019, 1111
EciI	GGCGGA	1 cut(s)	178
Eco130I	CCWWGG	1 cut(s)	258
Eco47I	GGWCC	2 cut(s)	244, 776
Eco57I	CTGAAG	1 cut(s)	651
Eco81I	CCTNAGG	1 cut(s)	127
EcoRI	GAATTC	1 cut(s)	618
EcoT14I	CCWWGG	1 cut(s)	258
ErhI	CCWWGG	1 cut(s)	258
Esp3I	CGTCTC	1 cut(s)	683
FaeI	CATG	9 cut(s)	40, 381, 398, 488, 724, 740, 869, 1097, 1118
FatI	CATG	9 cut(s)	36, 377, 394, 484, 720, 736, 865, 1093, 1114
FblI	GTMKAC	2 cut(s)	309, 318
Fnu4HI	GCNGC	4 cut(s)	54, 121, 859, 1131
FokI	GGATG	2 cut(s)	696, 1094
Fsp4HI	GCNGC	4 cut(s)	54, 121, 859, 1131
FspBI	CTAG	4 cut(s)	48, 365, 530, 1109
GluI	GCNGC	4 cut(s)	54, 121, 859, 1131
GsuI	CTGGAG	1 cut(s)	305
Hin1II	CATG	9 cut(s)	40, 381, 398, 488, 724, 740, 869, 1097, 1118
HinfI	GANTC	7 cut(s)	224, 232, 263, 269, 374, 1055, 1105
HphI	GGTGA	6 cut(s)	41, 471, 560, 698, 706, 811
Hpy166II	GTNNAC	5 cut(s)	45, 244, 310, 319, 779
Hpy188I	TCNGA	6 cut(s)	150, 268, 631, 750, 954, 1060
Hpy188III	TCNNGA	4 cut(s)	1102, 1109, 1115, 1157
Hpy8I	GTNNAC	5 cut(s)	45, 244, 310, 319, 779
HpyAV	CCTTC	3 cut(s)	8, 804, 1010
HpyCH4III	ACNGT	4 cut(s)	316, 335, 577, 694
HpyCH4IV	ACGT	1 cut(s)	781
HpyF10VI	GCNNNNNNNGC	2 cut(s)	766, 974
HpyF3I	CTNAG	2 cut(s)	127, 1137
HpySE526I	ACGT	1 cut(s)	781
Hsp92II	CATG	9 cut(s)	40, 381, 398, 488, 724, 740, 869, 1097, 1118
Kzo9I	GATC	3 cut(s)	862, 1019, 1111
LmnI	GCTCC	3 cut(s)	68, 128, 286
Lsp1109I	GCAGC	3 cut(s)	132, 845, 1117
LweI	GCATC	3 cut(s)	50, 485, 931
MaeI	CTAG	4 cut(s)	48, 365, 530, 1109
MaeII	ACGT	1 cut(s)	781
MalI	GATC	3 cut(s)	864, 1021, 1113
MboI	GATC	3 cut(s)	862, 1019, 1111
MboII	GAAGA	3 cut(s)	23, 215, 644
MluCI	AATT	8 cut(s)	5, 89, 490, 598, 618, 948, 1023, 1168
MlyI	GAGTC	3 cut(s)	241, 263, 1099
MnlI	CCTC	9 cut(s)	133, 136, 153, 159, 168, 289, 376, 562, 735
MroXI	GAANNNNTTC	1 cut(s)	555
MseI	TTAA	1 cut(s)	1026
Mva1269I	GAATGC	2 cut(s)	405, 426
MwoI	GCNNNNNNNGC	2 cut(s)	766, 974
NdeII	GATC	3 cut(s)	862, 1019, 1111
NlaIII	CATG	9 cut(s)	40, 381, 398, 488, 724, 740, 869, 1097, 1118
NspI	RCATGY	1 cut(s)	1097
PaeI	GCATGC	1 cut(s)	1097
PagI	TCATGA	1 cut(s)	1114
PctI	GAATGC	2 cut(s)	405, 426
PdmI	GAANNNNTTC	1 cut(s)	555
PfeI	GAWTC	4 cut(s)	224, 263, 374, 1055
PflMI	CCANNNNNTGG	1 cut(s)	259
PkrI	GCNGC	4 cut(s)	55, 122, 860, 1132
PleI	GAGTC	3 cut(s)	240, 263, 1099
PpsI	GAGTC	3 cut(s)	240, 263, 1099
PspPI	GGNCC	2 cut(s)	244, 776
PsrI	GAACNNNNNNTAC	2 cut(s)	716, 748
PstNI	CAGNNNCTG	1 cut(s)	333
RsaI	GTAC	5 cut(s)	392, 607, 731, 788, 872
RsaNI	GTAC	5 cut(s)	391, 606, 730, 787, 871
SaqAI	TTAA	1 cut(s)	1026
SatI	GCNGC	4 cut(s)	54, 121, 859, 1131
Sau3AI	GATC	3 cut(s)	862, 1019, 1111
Sau96I	GGNCC	2 cut(s)	244, 776
ScaI	AGTACT	1 cut(s)	731
SchI	GAGTC	3 cut(s)	241, 263, 1099
SfaNI	GCATC	3 cut(s)	50, 485, 931
SinI	GGWCC	2 cut(s)	244, 776
SphI	GCATGC	1 cut(s)	1097
Sse9I	AATT	8 cut(s)	5, 89, 490, 598, 618, 948, 1023, 1168
SsiI	CCGC	4 cut(s)	53, 163, 482, 546
SspMI	CTAG	4 cut(s)	48, 365, 530, 1109
StyI	CCWWGG	1 cut(s)	258
TaaI	ACNGT	4 cut(s)	316, 335, 577, 694
TaiI	ACGT	1 cut(s)	784
TaqI	TCGA	2 cut(s)	58, 579
TasI	AATT	8 cut(s)	5, 89, 490, 598, 618, 948, 1023, 1168
TatI	WGTACW	2 cut(s)	605, 729
TauI	GCSGC	1 cut(s)	56
TfiI	GAWTC	4 cut(s)	224, 263, 374, 1055
Tru1I	TTAA	1 cut(s)	1026
Tru9I	TTAA	1 cut(s)	1026
TscAI	CASTG	2 cut(s)	338, 466
TseI	GCWGC	3 cut(s)	120, 858, 1130
TspDTI	ATGAA	6 cut(s)	87, 366, 737, 1005, 1050, 1131
TspRI	CASTG	2 cut(s)	338, 466
Van91I	CCANNNNNTGG	1 cut(s)	259
VpaK11BI	GGWCC	2 cut(s)	244, 776
XapI	RAATTY	4 cut(s)	5, 89, 618, 1168
XbaI	TCTAGA	1 cut(s)	1108
XceI	RCATGY	1 cut(s)	1097
XcmI	CCANNNNNNNNNTGG	1 cut(s)	918
XmiI	GTMKAC	2 cut(s)	309, 318
XmnI	GAANNNNTTC	1 cut(s)	555
XspI	CTAG	4 cut(s)	48, 365, 530, 1109
ZrmI	AGTACT	1 cut(s)	731

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.