Rmu_sc0020968.1_g000002

Zinc-dependent metalloprotease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020968.1
OG0007485
Physical Location & Seq
Reverse (-)
1768 .. 2283
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020968.1_g000002.1.cds

Sequence Viewer

Length: 516 bp
atgtaccagaaaacctaccacttaaatgttactggaaagctcaattccgaaacaaaggaactgataaacactccgcgacgtggactgcctgatcataatctcatcaatggtagtgttcaaatgggttcctatcaagccttctttaatcttggacctacaaaatggccacctacaatgtaccatctcccatacagaatctctgccagagatgaaaccccaattgggaacgacgctgtggctcaagcatgtgctcaggcattcggattatgggccggtgtttccaactttacattcacaagcgtcggactagacgccccccatcaactcgacattagctttcgtcggggtcagcatcgacatgggaaaccgtttgatggcatattaaggcatgcattctaccccatggctggacttatgcatttggatgcagatgagaattggagtttgacacggccaaaatatgaccaatacgacttagtcgagtataccagtaccctttgttgttcttcgacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05206 map05206
Pfam Domains
Protein Families
PG_binding_1 Peptidase_M10

Protein Analysis

171

Amino Acids

19.33

Weight (kDa)

7.09

Isoelectric Point (pI)

37.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 485
AccII CGCG 1 cut(s) 76
AciI CCGC 1 cut(s) 74
AcoI YGGCCR 2 cut(s) 164, 452
AcyI GRCGYC 1 cut(s) 312
AfaI GTAC 3 cut(s) 5, 179, 493
AfiI CCNNNNNNNGG 4 cut(s) 80, 222, 374, 407
AgsI TTSAA 1 cut(s) 119
AjiI CACGTC 1 cut(s) 80
AjuI GAANNNNNNNTTGG 4 cut(s) 204, 236, 275, 307
AluBI AGCT 2 cut(s) 40, 336
AluI AGCT 2 cut(s) 40, 336
Alw21I GWGCWC 1 cut(s) 253
AoxI GGCC 3 cut(s) 164, 270, 452
AspS9I GGNCC 2 cut(s) 152, 270
AvaII GGWCC 1 cut(s) 152
BalI TGGCCA 1 cut(s) 166
Bbv12I GWGCWC 1 cut(s) 253
BccI CCATC 3 cut(s) 189, 327, 368
BceAI ACGGC 1 cut(s) 467
BclI TGATCA 1 cut(s) 91
BfaI CTAG 1 cut(s) 308
Bme18I GGWCC 1 cut(s) 152
BmgBI CACGTC 1 cut(s) 80
BmgT120I GGNCC 2 cut(s) 152, 270
BmiI GGNNCC 1 cut(s) 127
BmsI GCATC 2 cut(s) 361, 415
Bpu10I CCTNAGC 1 cut(s) 252
BpuEI CTTGAG 1 cut(s) 225
BsaBI GATNNNNATC 1 cut(s) 96
BsaHI GRCGYC 1 cut(s) 312
BsaJI CCNNGG 1 cut(s) 402
Bsc4I CCNNNNNNNGG 4 cut(s) 80, 222, 374, 407
Bse118I RCCGGY 1 cut(s) 272
Bse1I ACTGG 2 cut(s) 37, 489
Bse8I GATNNNNATC 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 402
BseGI GGATG 1 cut(s) 430
BseJI GATNNNNATC 1 cut(s) 96
BseLI CCNNNNNNNGG 4 cut(s) 80, 222, 374, 407
BseMII CTCAG 1 cut(s) 266
BseNI ACTGG 2 cut(s) 37, 489
Bsh1236I CGCG 1 cut(s) 76
BshFI GGCC 3 cut(s) 166, 272, 454
BsiHKAI GWGCWC 1 cut(s) 253
BsiSI CCGG 1 cut(s) 273
BslI CCNNNNNNNGG 4 cut(s) 80, 222, 374, 407
BsmI GAATGC 2 cut(s) 257, 392
BsnI GGCC 3 cut(s) 166, 272, 454
Bsp1286I GDGCHC 1 cut(s) 253
Bsp143I GATC 1 cut(s) 91
Bsp19I CCATGG 1 cut(s) 402
BspACI CCGC 1 cut(s) 74
BspANI GGCC 3 cut(s) 166, 272, 454
BspCNI CTCAG 1 cut(s) 265
BspFNI CGCG 1 cut(s) 76
BspLI GGNNCC 1 cut(s) 127
BsrFI RCCGGY 1 cut(s) 272
BsrI ACTGG 2 cut(s) 37, 489
BssAI RCCGGY 1 cut(s) 272
BssECI CCNNGG 1 cut(s) 402
BssMI GATC 1 cut(s) 91
BssNAI GTATAC 1 cut(s) 486
BssNI GRCGYC 1 cut(s) 312
BssT1I CCWWGG 1 cut(s) 402
Bst1107I GTATAC 1 cut(s) 486
Bst4CI ACNGT 1 cut(s) 369
BstACI GRCGYC 1 cut(s) 312
BstC8I GCNNGC 1 cut(s) 390
BstDEI CTNAG 3 cut(s) 252, 475, 513
BstDSI CCRYGG 1 cut(s) 402
BstF5I GGATG 1 cut(s) 430
BstFNI CGCG 1 cut(s) 76
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNSI RCATGY 2 cut(s) 249, 392
BstUI CGCG 1 cut(s) 76
BstZ17I GTATAC 1 cut(s) 486
BsuRI GGCC 3 cut(s) 166, 272, 454
BtgI CCRYGG 1 cut(s) 402
BtrI CACGTC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 430
Cac8I GCNNGC 1 cut(s) 390
Cfr10I RCCGGY 1 cut(s) 272
Cfr13I GGNCC 2 cut(s) 152, 270
CseI GACGC 3 cut(s) 239, 289, 320
Csp6I GTAC 3 cut(s) 4, 178, 492
CviAII CATG 4 cut(s) 246, 359, 389, 403
CviJI RGCY 8 cut(s) 40, 137, 166, 239, 272, 336, 407, 454
CviKI_1 RGCY 8 cut(s) 40, 137, 166, 239, 272, 336, 407, 454
CviQI GTAC 3 cut(s) 4, 178, 492
DdeI CTNAG 3 cut(s) 252, 475, 513
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
EaeI YGGCCR 2 cut(s) 164, 452
Eco130I CCWWGG 1 cut(s) 402
Eco47I GGWCC 1 cut(s) 152
EcoT14I CCWWGG 1 cut(s) 402
EcoT22I ATGCAT 2 cut(s) 394, 420
ErhI CCWWGG 1 cut(s) 402
FaeI CATG 4 cut(s) 249, 362, 392, 406
FatI CATG 4 cut(s) 245, 358, 388, 402
FbaI TGATCA 1 cut(s) 91
FblI GTMKAC 1 cut(s) 485
FokI GGATG 1 cut(s) 437
FspBI CTAG 1 cut(s) 308
HaeIII GGCC 3 cut(s) 166, 272, 454
HapII CCGG 1 cut(s) 273
HgaI GACGC 3 cut(s) 239, 289, 320
Hin1I GRCGYC 1 cut(s) 312
Hin1II CATG 4 cut(s) 249, 362, 392, 406
HinfI GANTC 1 cut(s) 195
HpaII CCGG 1 cut(s) 273
Hpy166II GTNNAC 2 cut(s) 83, 486
Hpy188I TCNGA 3 cut(s) 49, 263, 305
Hpy8I GTNNAC 2 cut(s) 83, 486
Hpy99I CGWCG 4 cut(s) 81, 233, 305, 345
HpyAV CCTTC 1 cut(s) 148
HpyCH4III ACNGT 1 cut(s) 369
HpyCH4IV ACGT 1 cut(s) 79
HpyCH4V TGCA 3 cut(s) 392, 418, 428
HpyF3I CTNAG 3 cut(s) 252, 475, 513
HpySE526I ACGT 1 cut(s) 79
Hsp92I GRCGYC 1 cut(s) 312
Hsp92II CATG 4 cut(s) 249, 362, 392, 406
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 8 cut(s) 18, 20, 102, 217, 239, 286, 393, 502
LweI GCATC 2 cut(s) 361, 415
MaeI CTAG 1 cut(s) 308
MaeII ACGT 1 cut(s) 79
MaeIII GTNAC 1 cut(s) 28
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 1 cut(s) 498
MfeI CAATTG 1 cut(s) 219
MhlI GDGCHC 1 cut(s) 253
MlsI TGGCCA 1 cut(s) 166
MluCI AATT 3 cut(s) 43, 219, 436
MluNI TGGCCA 1 cut(s) 166
MmeI TCCRAC 2 cut(s) 283, 306
Mox20I TGGCCA 1 cut(s) 166
Mph1103I ATGCAT 2 cut(s) 394, 420
MscI TGGCCA 1 cut(s) 166
MseI TTAA 3 cut(s) 23, 144, 383
MslI CAYNNNNRTG 3 cut(s) 24, 357, 423
Msp20I TGGCCA 1 cut(s) 166
MspI CCGG 1 cut(s) 273
MunI CAATTG 1 cut(s) 219
Mva1269I GAATGC 2 cut(s) 257, 392
MvnI CGCG 1 cut(s) 76
NcoI CCATGG 1 cut(s) 402
NdeII GATC 1 cut(s) 91
NlaIII CATG 4 cut(s) 249, 362, 392, 406
NlaIV GGNNCC 1 cut(s) 127
NsiI ATGCAT 2 cut(s) 394, 420
NspI RCATGY 2 cut(s) 249, 392
PaeI GCATGC 1 cut(s) 392
PcsI WCGNNNNNNNCGW 1 cut(s) 477
PctI GAATGC 2 cut(s) 257, 392
PfeI GAWTC 1 cut(s) 195
PflFI GACNNNGTC 1 cut(s) 476
PspN4I GGNNCC 1 cut(s) 127
PspPI GGNCC 2 cut(s) 152, 270
PsyI GACNNNGTC 1 cut(s) 476
RsaI GTAC 3 cut(s) 5, 179, 493
RsaNI GTAC 3 cut(s) 4, 178, 492
RseI CAYNNNNRTG 3 cut(s) 24, 357, 423
SaqAI TTAA 3 cut(s) 23, 144, 383
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 2 cut(s) 152, 270
SduI GDGCHC 1 cut(s) 253
SetI ASST 6 cut(s) 17, 42, 82, 157, 172, 338
SfaNI GCATC 2 cut(s) 361, 415
SinI GGWCC 1 cut(s) 152
SmiMI CAYNNNNRTG 3 cut(s) 24, 357, 423
SmlI CTYRAG 1 cut(s) 240
SmoI CTYRAG 1 cut(s) 240
SphI GCATGC 1 cut(s) 392
Sse9I AATT 3 cut(s) 43, 219, 436
SsiI CCGC 1 cut(s) 74
SspMI CTAG 1 cut(s) 308
StyI CCWWGG 1 cut(s) 402
TaaI ACNGT 1 cut(s) 369
TaiI ACGT 1 cut(s) 82
TaqI TCGA 4 cut(s) 327, 355, 480, 509
TasI AATT 3 cut(s) 43, 219, 436
TfiI GAWTC 1 cut(s) 195
Tru1I TTAA 3 cut(s) 23, 144, 383
Tru9I TTAA 3 cut(s) 23, 144, 383
TspDTI ATGAA 1 cut(s) 225
Tth111I GACNNNGTC 1 cut(s) 476
VpaK11BI GGWCC 1 cut(s) 152
XceI RCATGY 2 cut(s) 249, 392
XmiI GTMKAC 1 cut(s) 485
XspI CTAG 1 cut(s) 308
Zsp2I ATGCAT 2 cut(s) 394, 420
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.