Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0021850.1

Orthogroup ID

OG0015589

Physical Location & Seq

Genomic Coordinates Forward (+)

183 .. 590

Gene Structure 408 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0021850.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 279 bp

atgaggaagttttgtgtcattaacgtctcacacaacaaagccaaggtcgggggatctagaaaaaagaagacaacacgctgtcaacgccctgcaccagaaactgatgatcagaataggacctgtacaaattttaattgtcgggtcagcgaaactccaatgtggcgtagaggacctctggagtcaaagacactttggaacgcttgtgggatcaagtatcgcaagctcaagctcaaggaggaacaaggggagggaacttcaggaaagggcagctctaactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0006810 GO:0008150 GO:0015399 GO:0015405 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0031090 GO:0042623 GO:0042626 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043492 GO:0044422 GO:0044424 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0098588 GO:0098805

KEGG Pathways

Metabolic & Signaling

ko01523 ko01524 ko02010 ko04976 map01523 map01524 map02010 map04976

Pfam Domains

Protein Families

ABC_membrane ABC_tran

Protein Analysis

92

Amino Acids

10.45

Weight (kDa)

10.1

Isoelectric Point (pI)

36.43

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015589)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g44220 FvH4_3g44240
rosa_laevigata	RLG00000036869 RLG00000036870
rosa_multiflora	Rmu_sc0000359.1_g000002 Rmu_sc0021850.1_g000001
rosa_roxburghii	Rroxscaffold_1G00002800 Rroxscaffold_1G00002810
rosa_rugosa	Rorug05G0470300 Rorug05G0470400
rosa_samantha	Rh5AG523700 Rh5BG545800 Rh5CG569000 Rh5DG488600 Rh5DG555900 Rh5DG556000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	61, 215
AcsI	RAATTY	1 cut(s)	127
AcuI	CTGAAG	1 cut(s)	240
AfaI	GTAC	1 cut(s)	124
AfiI	CCNNNNNNNGG	1 cut(s)	48
AluBI	AGCT	3 cut(s)	223, 229, 270
AluI	AGCT	3 cut(s)	223, 229, 270
Alw26I	GTCTC	1 cut(s)	31
AlwI	GGATC	2 cut(s)	61, 215
AlwNI	CAGNNNCTG	1 cut(s)	101
ApeKI	GCWGC	1 cut(s)	267
ApoI	RAATTY	1 cut(s)	127
ArsI	GACNNNNNNTTYG	2 cut(s)	30, 62
AspS9I	GGNCC	2 cut(s)	117, 170
AvaII	GGWCC	2 cut(s)	117, 170
BbsI	GAAGAC	1 cut(s)	74
BclI	TGATCA	1 cut(s)	106
BcoDI	GTCTC	1 cut(s)	31
BfaI	CTAG	1 cut(s)	57
BisI	GCNGC	1 cut(s)	268
BlsI	GCNGC	1 cut(s)	269
Bme18I	GGWCC	2 cut(s)	117, 170
BmgT120I	GGNCC	2 cut(s)	117, 170
BpiI	GAAGAC	1 cut(s)	74
BpmI	CTGGAG	1 cut(s)	197
BpuEI	CTTGAG	2 cut(s)	209, 215
BsaJI	CCNNGG	1 cut(s)	42
Bsc4I	CCNNNNNNNGG	1 cut(s)	48
BseDI	CCNNGG	1 cut(s)	42
BseLI	CCNNNNNNNGG	1 cut(s)	48
BsgI	GTGCAG	1 cut(s)	75
BslI	CCNNNNNNNGG	1 cut(s)	48
BsmAI	GTCTC	1 cut(s)	31
BsmBI	CGTCTC	1 cut(s)	31
Bsp1407I	TGTACA	1 cut(s)	122
Bsp143I	GATC	3 cut(s)	53, 106, 207
BspPI	GGATC	2 cut(s)	61, 215
BsrGI	TGTACA	1 cut(s)	122
BssECI	CCNNGG	1 cut(s)	42
BssMI	GATC	3 cut(s)	53, 106, 207
BssT1I	CCWWGG	1 cut(s)	42
BstAUI	TGTACA	1 cut(s)	122
BstC8I	GCNNGC	1 cut(s)	221
BstKTI	GATC	3 cut(s)	56, 109, 210
BstMAI	GTCTC	1 cut(s)	31
BstMBI	GATC	3 cut(s)	53, 106, 207
BstMWI	GCNNNNNNNGC	1 cut(s)	84
BstV2I	GAAGAC	1 cut(s)	74
BstX2I	RGATCY	1 cut(s)	53
BstYI	RGATCY	1 cut(s)	53
Cac8I	GCNNGC	1 cut(s)	221
CaiI	CAGNNNCTG	1 cut(s)	101
Cfr13I	GGNCC	2 cut(s)	117, 170
Csp6I	GTAC	1 cut(s)	123
CviJI	RGCY	4 cut(s)	41, 223, 229, 270
CviKI_1	RGCY	4 cut(s)	41, 223, 229, 270
CviQI	GTAC	1 cut(s)	123
DpnI	GATC	3 cut(s)	55, 108, 209
DpnII	GATC	3 cut(s)	53, 106, 207
Eco130I	CCWWGG	1 cut(s)	42
Eco47I	GGWCC	2 cut(s)	117, 170
Eco57I	CTGAAG	1 cut(s)	240
EcoO109I	RGGNCCY	2 cut(s)	117, 170
EcoT14I	CCWWGG	1 cut(s)	42
ErhI	CCWWGG	1 cut(s)	42
Esp3I	CGTCTC	1 cut(s)	31
FbaI	TGATCA	1 cut(s)	106
Fnu4HI	GCNGC	1 cut(s)	268
Fsp4HI	GCNGC	1 cut(s)	268
FspBI	CTAG	1 cut(s)	57
GluI	GCNGC	1 cut(s)	268
GsuI	CTGGAG	1 cut(s)	197
HincII	GTYRAC	1 cut(s)	83
HindII	GTYRAC	1 cut(s)	83
HinfI	GANTC	1 cut(s)	179
Hpy166II	GTNNAC	1 cut(s)	83
Hpy188I	TCNGA	1 cut(s)	111
Hpy188III	TCNNGA	3 cut(s)	57, 176, 258
Hpy8I	GTNNAC	1 cut(s)	83
HpyCH4IV	ACGT	1 cut(s)	24
HpyCH4V	TGCA	1 cut(s)	92
HpyF10VI	GCNNNNNNNGC	1 cut(s)	84
HpySE526I	ACGT	1 cut(s)	24
Ksp22I	TGATCA	1 cut(s)	106
Kzo9I	GATC	3 cut(s)	53, 106, 207
LpnPI	CCDG	5 cut(s)	102, 108, 133, 161, 243
MaeI	CTAG	1 cut(s)	57
MaeII	ACGT	1 cut(s)	24
MalI	GATC	3 cut(s)	55, 108, 209
MboI	GATC	3 cut(s)	53, 106, 207
MboII	GAAGA	1 cut(s)	79
MflI	RGATCY	1 cut(s)	53
MluCI	AATT	2 cut(s)	127, 133
MlyI	GAGTC	1 cut(s)	188
MnlI	CCTC	4 cut(s)	161, 183, 229, 241
MseI	TTAA	2 cut(s)	21, 132
MwoI	GCNNNNNNNGC	1 cut(s)	84
NdeII	GATC	3 cut(s)	53, 106, 207
PkrI	GCNGC	1 cut(s)	269
PleI	GAGTC	1 cut(s)	187
PpsI	GAGTC	1 cut(s)	187
PpuMI	RGGWCCY	2 cut(s)	117, 170
Psp5II	RGGWCCY	2 cut(s)	117, 170
PspPI	GGNCC	2 cut(s)	117, 170
PspPPI	RGGWCCY	2 cut(s)	117, 170
PstNI	CAGNNNCTG	1 cut(s)	101
PsuI	RGATCY	1 cut(s)	53
RsaI	GTAC	1 cut(s)	124
RsaNI	GTAC	1 cut(s)	123
SaqAI	TTAA	2 cut(s)	21, 132
SatI	GCNGC	1 cut(s)	268
Sau3AI	GATC	3 cut(s)	53, 106, 207
Sau96I	GGNCC	2 cut(s)	117, 170
SchI	GAGTC	1 cut(s)	188
SetI	ASST	7 cut(s)	27, 48, 122, 175, 225, 231, 272
SinI	GGWCC	2 cut(s)	117, 170
SmlI	CTYRAG	2 cut(s)	224, 230
SmoI	CTYRAG	2 cut(s)	224, 230
Sse9I	AATT	2 cut(s)	127, 133
SspMI	CTAG	1 cut(s)	57
StyI	CCWWGG	1 cut(s)	42
TaiI	ACGT	1 cut(s)	27
TasI	AATT	2 cut(s)	127, 133
TatI	WGTACW	1 cut(s)	122
Tru1I	TTAA	2 cut(s)	21, 132
Tru9I	TTAA	2 cut(s)	21, 132
TseI	GCWGC	1 cut(s)	267
VpaK11BI	GGWCC	2 cut(s)	117, 170
XapI	RAATTY	1 cut(s)	127
XbaI	TCTAGA	1 cut(s)	56
XspI	CTAG	1 cut(s)	57

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.