Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0024007.1

Orthogroup ID

OG0004991

Physical Location & Seq

Genomic Coordinates Reverse (-)

3047 .. 5992

Gene Structure 2946 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0024007.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1284 bp

atgggtttcgctcagtttagcagagggaggtctaggttagctctagcagtgctggtttgcttcttgttcatctctctgtcctgtgaggccagattgactgcttcatcaagacagaagcttgatgttcagaagcacctcaaccgtttgaacaagcctgctgtgaaaagcatcaagagcccagatggggatataatagactgtgttcacatctctcagcaacctgcttttgatcatccttacctcaaagaccacaaaattcagatgaggcctaactaccacccagaaggcttatttcaagaaaacaaagttgctgaaaaatcgaaagaaatgccaaacacccagctgtggcatgtgaatggaagatgccctgaagataccatacccgtgaggaggacgaagaaagatgatattctgagagcaagctcagtcaaaagatatgggcggaagaaggagaaaaccattccaaagtctgcagatcctgatcttgccaatgagagtggtcatcagcatgcaattgcttatgtaaatggagacaagtattttggagcaaaagcaaccatcaatgtctgggagcccaagattcaacagcctaatgagttcagcttgtctcagctttggatattaggagggtcttttggtgaagacctgaacagcattgaagctggttggcaggtcagcccagacctctatggtgacaacaacacaagactatttacctattggactagtgatgcatatcaagccactggttgctacaacctcctgtgctcgggctttattcaaatcaacagtgaaatagcaatgggcgcaagcatctctcctgtgtcaagctaccgaacttcccaatacgatatcagcatacttgtctggaaggatccaaaggagggacattggtggatgcagttcggcaatgactatgtgttggggtattggccttctttcctgttctcgtacttggccgacagtgcttccatgattgagtggggaggtgaggttgtaaattcgcagtcggatggccgacacacctcaactcaaatgggcagtggtcgttttccggaggagggttttggaaaatcaagttatttcaggaacattcaagttgttgatagctccaataatctcaaggcccccaaagggttaggcaccttcaccgagcagtcaaactgctatgatgttcagacaggaagtaatggggattggggtcactacttttactatggaggaccaggttgggctgtggctggtcttagtagtaaatcatgtgatggtcccttttctctctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Neprosin Neprosin_AP

Protein Analysis

427

Amino Acids

47.87

Weight (kDa)

7.15

Isoelectric Point (pI)

44.01

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004991)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G55360 AT3G13510 AT5G56530 AT5G56530
fragaria_vesca	FvH4_3g45750 FvH4_3g45750 FvH4_3g45750 FvH4_3g45750 FvH4_3g45750 FvH4_3g45750
malus_domestica	MD03G1003500.v1.1 MD11G1003400.v1.1
prunus_persica	Prupe.6G003200_v2.0.a1 Prupe.6G003200_v2.0.a1 Prupe.6G003200_v2.0.a1
pyrus_communis	pycom03g00350 pycom11g00300
rosa_chinensis	RchiOBHm_Chr5g0083821
rosa_laevigata	RLG00000037054
rosa_multiflora	Rmu_sc0024007.1_g000001
rosa_roxburghii	Rroxscaffold_1G00000770
rosa_rugosa	Rorug05G0486300 Rorug05G0486300 Rorug05G0486300 Rorug05G0486300 Rorug05G0486300
rosa_samantha	Rh5AG539300 Rh5CG586500 Rh5DG573000
rosa_wichuraiana	Rw5G050140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	229, 661
AccB1I	GGYRCC	1 cut(s)	1142
AccIII	TCCGGA	1 cut(s)	1054
AciI	CCGC	1 cut(s)	442
AclWI	GGATC	3 cut(s)	470, 869, 882
AcoI	YGGCCR	2 cut(s)	957, 1015
AcsI	RAATTY	2 cut(s)	255, 1000
AcuI	CTGAAG	1 cut(s)	390
AfaI	GTAC	1 cut(s)	953
AfiI	CCNNNNNNNGG	7 cut(s)	184, 345, 390, 769, 884, 1061, 1134
AgsI	TTSAA	6 cut(s)	148, 296, 584, 659, 782, 1097
AhlI	ACTAGT	1 cut(s)	725
AjnI	CCWGG	1 cut(s)	1225
AluBI	AGCT	9 cut(s)	41, 118, 343, 423, 603, 613, 662, 831, 1110
AluI	AGCT	9 cut(s)	41, 118, 343, 423, 603, 613, 662, 831, 1110
Alw21I	GWGCWC	1 cut(s)	770
Alw26I	GTCTC	2 cut(s)	525, 612
AlwI	GGATC	3 cut(s)	470, 869, 882
AlwNI	CAGNNNCTG	1 cut(s)	479
Ama87I	CYCGRG	1 cut(s)	769
Aor13HI	TCCGGA	1 cut(s)	1054
AoxI	GGCC	6 cut(s)	87, 266, 932, 957, 1015, 1125
ApoI	RAATTY	2 cut(s)	255, 1000
ArsI	GACNNNNNNTTYG	2 cut(s)	524, 556
AspLEI	GCGC	1 cut(s)	809
AspS9I	GGNCC	3 cut(s)	1126, 1223, 1268
AsuHPI	GGTGA	4 cut(s)	650, 704, 1001, 1141
AvaI	CYCGRG	1 cut(s)	769
AvaII	GGWCC	2 cut(s)	1223, 1268
BamHI	GGATCC	1 cut(s)	874
BanI	GGYRCC	1 cut(s)	1142
BanII	GRGCYC	2 cut(s)	179, 576
BarI	GAAGNNNNNNTAC	2 cut(s)	363, 395
BbsI	GAAGAC	1 cut(s)	648
Bbv12I	GWGCWC	1 cut(s)	770
BccI	CCATC	4 cut(s)	176, 566, 1007, 1259
BcgI	CGANNNNNNTGC	2 cut(s)	310, 344
BciT130I	CCWGG	1 cut(s)	1227
BclI	TGATCA	1 cut(s)	229
BcoDI	GTCTC	2 cut(s)	525, 612
BcuI	ACTAGT	1 cut(s)	725
BfaI	CTAG	4 cut(s)	33, 44, 726, 1282
BfmI	CTRYAG	1 cut(s)	471
BfuAI	ACCTGC	2 cut(s)	229, 661
Bme1390I	CCNGG	1 cut(s)	1227
Bme18I	GGWCC	2 cut(s)	1223, 1268
BmeT110I	CYCGRG	1 cut(s)	769
BmgT120I	GGNCC	3 cut(s)	1126, 1223, 1268
BmiI	GGNNCC	5 cut(s)	573, 876, 1128, 1144, 1270
BmrFI	CCNGG	1 cut(s)	1227
BmsI	GCATC	5 cut(s)	177, 353, 721, 822, 888
BpiI	GAAGAC	1 cut(s)	648
BpuEI	CTTGAG	1 cut(s)	1106
BsaBI	GATNNNNATC	2 cut(s)	480, 735
BsaWI	WCCGGW	1 cut(s)	1054
BsaXI	ACNNNNNCTCC	2 cut(s)	978, 1008
Bsc4I	CCNNNNNNNGG	7 cut(s)	184, 345, 390, 769, 884, 1061, 1134
Bse1I	ACTGG	1 cut(s)	751
Bse3DI	GCAATG	2 cut(s)	807, 916
Bse8I	GATNNNNATC	2 cut(s)	480, 735
BseAI	TCCGGA	1 cut(s)	1054
BseBI	CCWGG	1 cut(s)	1227
BseGI	GGATG	3 cut(s)	232, 903, 1018
BseJI	GATNNNNATC	2 cut(s)	480, 735
BseLI	CCNNNNNNNGG	7 cut(s)	184, 345, 390, 769, 884, 1061, 1134
BseMI	GCAATG	2 cut(s)	807, 916
BseMII	CTCAG	5 cut(s)	26, 227, 404, 438, 623
BseNI	ACTGG	1 cut(s)	751
BseRI	GAGGAG	2 cut(s)	403, 1073
BseYI	CCCAGC	1 cut(s)	339
BshFI	GGCC	6 cut(s)	89, 268, 934, 959, 1017, 1127
BshNI	GGYRCC	1 cut(s)	1142
BsiHKAI	GWGCWC	1 cut(s)	770
BsiHKCI	CYCGRG	1 cut(s)	769
BsiSI	CCGG	1 cut(s)	1055
BslFI	GGGAC	2 cut(s)	900, 1254
BslI	CCNNNNNNNGG	7 cut(s)	184, 345, 390, 769, 884, 1061, 1134
BsmAI	GTCTC	2 cut(s)	525, 612
BsmFI	GGGAC	2 cut(s)	900, 1254
BsnI	GGCC	6 cut(s)	89, 268, 934, 959, 1017, 1127
BsoBI	CYCGRG	1 cut(s)	769
Bsp1286I	GDGCHC	3 cut(s)	179, 576, 770
Bsp13I	TCCGGA	1 cut(s)	1054
Bsp143I	GATC	4 cut(s)	229, 475, 481, 874
BspACI	CCGC	1 cut(s)	442
BspANI	GGCC	6 cut(s)	89, 268, 934, 959, 1017, 1127
BspCNI	CTCAG	5 cut(s)	25, 226, 405, 437, 622
BspEI	TCCGGA	1 cut(s)	1054
BspLI	GGNNCC	5 cut(s)	573, 876, 1128, 1144, 1270
BspMAI	CTGCAG	1 cut(s)	475
BspMI	ACCTGC	2 cut(s)	229, 661
BspPI	GGATC	3 cut(s)	470, 869, 882
BspT107I	GGYRCC	1 cut(s)	1142
BsrDI	GCAATG	2 cut(s)	807, 916
BsrI	ACTGG	1 cut(s)	751
BssMI	GATC	4 cut(s)	229, 475, 481, 874
Bst2UI	CCWGG	1 cut(s)	1227
Bst4CI	ACNGT	4 cut(s)	143, 200, 791, 965
BstC8I	GCNNGC	4 cut(s)	156, 421, 510, 811
BstDEI	CTNAG	6 cut(s)	12, 213, 413, 424, 609, 1247
BstF5I	GGATG	3 cut(s)	232, 903, 1018
BstHHI	GCGC	1 cut(s)	809
BstKTI	GATC	4 cut(s)	232, 478, 484, 877
BstMAI	GTCTC	2 cut(s)	525, 612
BstMBI	GATC	4 cut(s)	229, 475, 481, 874
BstMWI	GCNNNNNNNGC	4 cut(s)	174, 740, 806, 965
BstNI	CCWGG	1 cut(s)	1227
BstNSI	RCATGY	2 cut(s)	353, 512
BstSCI	CCNGG	1 cut(s)	1225
BstSFI	CTRYAG	1 cut(s)	471
BstV2I	GAAGAC	1 cut(s)	648
BstX2I	RGATCY	2 cut(s)	475, 874
BstYI	RGATCY	2 cut(s)	475, 874
BsuRI	GGCC	6 cut(s)	89, 268, 934, 959, 1017, 1127
BtsCI	GGATG	3 cut(s)	232, 903, 1018
BtsI	GCAGTG	2 cut(s)	54, 1048
BtsIMutI	CAGTG	5 cut(s)	54, 744, 796, 970, 1048
BveI	ACCTGC	2 cut(s)	229, 661
Cac8I	GCNNGC	4 cut(s)	156, 421, 510, 811
CaiI	CAGNNNCTG	1 cut(s)	479
CfoI	GCGC	1 cut(s)	809
Cfr13I	GGNCC	3 cut(s)	1126, 1223, 1268
CsiI	ACCWGGT	1 cut(s)	1225
Csp6I	GTAC	1 cut(s)	952
CspCI	CAANNNNNGTGG	2 cut(s)	478, 513
CviAII	CATG	4 cut(s)	350, 509, 973, 1260
CviQI	GTAC	1 cut(s)	952
DdeI	CTNAG	6 cut(s)	12, 213, 413, 424, 609, 1247
DpnI	GATC	4 cut(s)	231, 477, 483, 876
DpnII	GATC	4 cut(s)	229, 475, 481, 874
EaeI	YGGCCR	2 cut(s)	957, 1015
EciI	GGCGGA	1 cut(s)	457
Eco147I	AGGCCT	1 cut(s)	268
Eco24I	GRGCYC	2 cut(s)	179, 576
Eco32I	GATATC	1 cut(s)	853
Eco47I	GGWCC	2 cut(s)	1223, 1268
Eco57I	CTGAAG	1 cut(s)	390
Eco88I	CYCGRG	1 cut(s)	769
EcoO109I	RGGNCCY	1 cut(s)	1126
EcoRII	CCWGG	1 cut(s)	1225
EcoRV	GATATC	1 cut(s)	853
EcoT22I	ATGCAT	1 cut(s)	736
EcoT38I	GRGCYC	2 cut(s)	179, 576
FaeI	CATG	4 cut(s)	353, 512, 976, 1263
FaqI	GGGAC	2 cut(s)	900, 1254
FatI	CATG	4 cut(s)	349, 508, 972, 1259
FbaI	TGATCA	1 cut(s)	229
FokI	GGATG	3 cut(s)	219, 910, 1025
FriOI	GRGCYC	2 cut(s)	179, 576
FspBI	CTAG	4 cut(s)	33, 44, 726, 1282
GlaI	GCGC	1 cut(s)	808
GsaI	CCCAGC	1 cut(s)	343
HaeIII	GGCC	6 cut(s)	89, 268, 934, 959, 1017, 1127
HapII	CCGG	1 cut(s)	1055
HhaI	GCGC	1 cut(s)	809
Hin1II	CATG	4 cut(s)	353, 512, 976, 1263
Hin6I	GCGC	1 cut(s)	807
HinP1I	GCGC	1 cut(s)	807
HindIII	AAGCTT	1 cut(s)	116
HinfI	GANTC	1 cut(s)	580
HpaII	CCGG	1 cut(s)	1055
HphI	GGTGA	4 cut(s)	650, 704, 1001, 1141
Hpy166II	GTNNAC	1 cut(s)	205
Hpy188I	TCNGA	5 cut(s)	129, 261, 414, 1012, 1179
Hpy188III	TCNNGA	7 cut(s)	108, 172, 296, 479, 868, 1055, 1087
Hpy8I	GTNNAC	1 cut(s)	205
HpyAV	CCTTC	5 cut(s)	278, 442, 865, 945, 1156
HpyCH4III	ACNGT	4 cut(s)	143, 200, 791, 965
HpyCH4V	TGCA	4 cut(s)	473, 512, 734, 901
HpyF10VI	GCNNNNNNNGC	4 cut(s)	174, 740, 806, 965
HpyF3I	CTNAG	6 cut(s)	12, 213, 413, 424, 609, 1247
Hsp92II	CATG	4 cut(s)	353, 512, 976, 1263
HspAI	GCGC	1 cut(s)	807
Kpn2I	TCCGGA	1 cut(s)	1054
Ksp22I	TGATCA	1 cut(s)	229
Kzo9I	GATC	4 cut(s)	229, 475, 481, 874
LmnI	GCTCC	3 cut(s)	545, 571, 1115
LweI	GCATC	5 cut(s)	177, 353, 721, 822, 888
MabI	ACCWGGT	1 cut(s)	1225
MaeI	CTAG	4 cut(s)	33, 44, 726, 1282
MaeIII	GTNAC	2 cut(s)	692, 1202
MalI	GATC	4 cut(s)	231, 477, 483, 876
MboI	GATC	4 cut(s)	229, 475, 481, 874
MboII	GAAGA	5 cut(s)	372, 383, 409, 457, 653
MfeI	CAATTG	1 cut(s)	513
MflI	RGATCY	2 cut(s)	475, 874
MhlI	GDGCHC	3 cut(s)	179, 576, 770
MluCI	AATT	3 cut(s)	255, 513, 1000
MmeI	TCCRAC	1 cut(s)	990
Mph1103I	ATGCAT	1 cut(s)	736
MroI	TCCGGA	1 cut(s)	1054
MslI	CAYNNNNRTG	3 cut(s)	354, 383, 507
MspA1I	CMGCKG	1 cut(s)	343
MspI	CCGG	1 cut(s)	1055
MspR9I	CCNGG	1 cut(s)	1227
MunI	CAATTG	1 cut(s)	513
MvaI	CCWGG	1 cut(s)	1227
MwoI	GCNNNNNNNGC	4 cut(s)	174, 740, 806, 965
NdeII	GATC	4 cut(s)	229, 475, 481, 874
NlaIII	CATG	4 cut(s)	353, 512, 976, 1263
NlaIV	GGNNCC	5 cut(s)	573, 876, 1128, 1144, 1270
NmuCI	GTSAC	2 cut(s)	692, 1202
NsiI	ATGCAT	1 cut(s)	736
NspI	RCATGY	2 cut(s)	353, 512
PaeI	GCATGC	1 cut(s)	512
PceI	AGGCCT	1 cut(s)	268
PfeI	GAWTC	1 cut(s)	580
Psp6I	CCWGG	1 cut(s)	1225
PspFI	CCCAGC	1 cut(s)	339
PspGI	CCWGG	1 cut(s)	1225
PspN4I	GGNNCC	5 cut(s)	573, 876, 1128, 1144, 1270
PspPI	GGNCC	3 cut(s)	1126, 1223, 1268
PstI	CTGCAG	1 cut(s)	475
PstNI	CAGNNNCTG	1 cut(s)	479
PsuI	RGATCY	2 cut(s)	475, 874
PvuII	CAGCTG	1 cut(s)	343
RsaI	GTAC	1 cut(s)	953
RsaNI	GTAC	1 cut(s)	952
RseI	CAYNNNNRTG	3 cut(s)	354, 383, 507
Sau3AI	GATC	4 cut(s)	229, 475, 481, 874
Sau96I	GGNCC	3 cut(s)	1126, 1223, 1268
ScrFI	CCNGG	1 cut(s)	1227
SduI	GDGCHC	3 cut(s)	179, 576, 770
SexAI	ACCWGGT	1 cut(s)	1225
SfaNI	GCATC	5 cut(s)	177, 353, 721, 822, 888
SfcI	CTRYAG	1 cut(s)	471
SinI	GGWCC	2 cut(s)	1223, 1268
SmiMI	CAYNNNNRTG	3 cut(s)	354, 383, 507
SmlI	CTYRAG	1 cut(s)	1121
SmoI	CTYRAG	1 cut(s)	1121
SpeI	ACTAGT	1 cut(s)	725
SphI	GCATGC	1 cut(s)	512
Sse9I	AATT	3 cut(s)	255, 513, 1000
SseBI	AGGCCT	1 cut(s)	268
SsiI	CCGC	1 cut(s)	442
SspMI	CTAG	4 cut(s)	33, 44, 726, 1282
StuI	AGGCCT	1 cut(s)	268
StyD4I	CCNGG	1 cut(s)	1225
TaaI	ACNGT	4 cut(s)	143, 200, 791, 965
TaqI	TCGA	1 cut(s)	320
TasI	AATT	3 cut(s)	255, 513, 1000
TfiI	GAWTC	1 cut(s)	580
TscAI	CASTG	5 cut(s)	54, 751, 796, 970, 1048
TseFI	GTSAC	2 cut(s)	692, 1202
Tsp45I	GTSAC	2 cut(s)	692, 1202
TspDTI	ATGAA	2 cut(s)	58, 93
TspRI	CASTG	5 cut(s)	54, 751, 796, 970, 1048
VpaK11BI	GGWCC	2 cut(s)	1223, 1268
XapI	RAATTY	2 cut(s)	255, 1000
XceI	RCATGY	2 cut(s)	353, 512
XspI	CTAG	4 cut(s)	33, 44, 726, 1282
Zsp2I	ATGCAT	1 cut(s)	736

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.