Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0027439.1

Orthogroup ID

OG0004143

Physical Location & Seq

Genomic Coordinates Forward (+)

3525 .. 12626

Gene Structure 9102 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0027439.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1293 bp

atgtccattgtttggcttttgatttcattcacgtacctatcatatctgcatggagcctgcgtcatatttatcctctcaatcgcttcagtgaattttcttttagtaaagatatttgctcgaacgaagtacttctcttttgtattctggagtttcaacatcttctttcttctctgcaatcgtatttatggaggatactcattctcctcatttggggagcactgggcatttttggacaactttcggggcacctttagatggcaaatttgctttaactttgttgttttgcgcatggtaagctttggctatgaataccattgggctcatcaagattctcgtttcgaccatgagaaacatattcagcgttgcaatatttgtagagccggaaaaacttgttaccaagtgttacaggagagaggtgtccagagcgacaagtttgcctatatcacatacctttcttatctggcatatgcacctctttatcttgcgggcccaattctaagcttcaatgcctttgcttcacagctggatattcctcaaaacaattattcagttagagacactacttggtacggtttgcgttgggtgttcagtctccttctgatggaactaatgacacatctcttttactacaatgccttcgcaatcagcggcatgtggaaacagttatatccagtagatgtgtttattattggatatggggttttaaactttatgtggctaaagttctttctgatatggcgctatttccggttctggtcactgatctgtggcattgaggtccctgagaatatgccaaagtgtgtaaacaattgctacaacttggaaagcttttggaagaactggcatgcttcctacaacaaatggcttgtgaggtatttgtacatacctcttggcggctctcagagaaagcttctcaatgtgtgggttgtattcacattcgttgccatttggcatgatctagagtggaagcttctttcatgggcatggctgacatgcttattctttattccggaaataatcttcaaatcagcagccgctgcatttcaggccaagactgctcttggggagtttattgttcgtgaatttagtgcagctgctggggcggttacaatcacttgcctcatggttgcaaaccttgttggttttgtgattggaccatctgggattagttggttggtttctcaattccttagcagagacggattaccagtcttggctggcatgcttttgacattttatgttgggacaaagcttatgttccacatccgtgatgcaaaacaaagtacccactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MBOAT

Protein Analysis

430

Amino Acids

50.46

Weight (kDa)

9.12

Isoelectric Point (pI)

31.32

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004143)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G57600 AT1G57600 AT1G57600 AT1G57600
fragaria_vesca	FvH4_7g05560 FvH4_7g05560 FvH4_7g05560 FvH4_7g05560 FvH4_7g05560
malus_domestica	MD08G1246100.v1.1 MD15G1441300.v1.1
prunus_persica	Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1 Prupe.1G583400_v2.0.a1
pyrus_communis	pycom08g21360
rosa_chinensis	RchiOBHm_Chr1g0332651
rosa_laevigata	RLG00000029649
rosa_multiflora	Rmu_sc0027439.1_g000001
rosa_roxburghii	Rroxscaffold_1G00014710 Rroxscaffold_1G00014720 Rroxscaffold_4G00318080
rosa_rugosa	Rorug01G0105200
rosa_samantha	Rh1AG127000 Rh1BG096700 Rh1DG132200
rosa_wichuraiana	Rw1G010580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	287
AccB1I	GGYRCC	1 cut(s)	245
AccB7I	CCANNNNNTGG	1 cut(s)	12
AccIII	TCCGGA	1 cut(s)	1009
AciI	CCGC	5 cut(s)	485, 648, 894, 1035, 1103
AcsI	RAATTY	3 cut(s)	91, 261, 1082
AcuI	CTGAAG	1 cut(s)	69
AfaI	GTAC	5 cut(s)	35, 128, 569, 881, 1285
AfiI	CCNNNNNNNGG	5 cut(s)	12, 210, 255, 601, 893
AgsI	TTSAA	3 cut(s)	154, 505, 1024
AleI	CACNNNNGTG	1 cut(s)	1266
AluBI	AGCT	8 cut(s)	297, 501, 523, 828, 910, 970, 1094, 1252
AluI	AGCT	8 cut(s)	297, 501, 523, 828, 910, 970, 1094, 1252
Alw21I	GWGCWC	1 cut(s)	219
Alw26I	GTCTC	3 cut(s)	549, 596, 1191
AlwNI	CAGNNNCTG	2 cut(s)	1037, 1097
Aor13HI	TCCGGA	1 cut(s)	1009
AoxI	GGCC	2 cut(s)	487, 1047
ApaI	GGGCCC	1 cut(s)	491
ApeKI	GCWGC	4 cut(s)	1031, 1037, 1091, 1094
ApoI	RAATTY	3 cut(s)	91, 261, 1082
Asp700I	GAANNNNTTC	1 cut(s)	128
AspLEI	GCGC	2 cut(s)	288, 741
AspS9I	GGNCC	4 cut(s)	487, 488, 778, 1154
AvaII	GGWCC	2 cut(s)	778, 1154
BaeGI	GKGCMC	2 cut(s)	248, 491
BanI	GGYRCC	1 cut(s)	245
BanII	GRGCYC	2 cut(s)	322, 491
Bbv12I	GWGCWC	1 cut(s)	219
BbvI	GCAGC	4 cut(s)	1024, 1043, 1081, 1103
BccI	CCATC	3 cut(s)	249, 595, 1165
BcgI	CGANNNNNNTGC	2 cut(s)	416, 450
BciVI	GTATCC	1 cut(s)	185
BcoDI	GTCTC	3 cut(s)	549, 596, 1191
BfaI	CTAG	1 cut(s)	959
BfoI	RGCGCY	1 cut(s)	742
BfuI	GTATCC	1 cut(s)	185
BisI	GCNGC	7 cut(s)	649, 895, 1032, 1035, 1038, 1092, 1095
BlsI	GCNGC	7 cut(s)	650, 896, 1033, 1036, 1039, 1093, 1096
BmcAI	AGTACT	1 cut(s)	128
Bme18I	GGWCC	2 cut(s)	778, 1154
BmgT120I	GGNCC	4 cut(s)	487, 488, 778, 1154
BmiI	GGNNCC	4 cut(s)	55, 247, 489, 780
BmrI	ACTGGG	1 cut(s)	229
BmsI	GCATC	1 cut(s)	1261
BmuI	ACTGGG	1 cut(s)	229
BpmI	CTGGAG	1 cut(s)	166
Bpu10I	CCTNAGC	1 cut(s)	1190
BsaAI	YACGTR	1 cut(s)	33
BsaWI	WCCGGW	2 cut(s)	747, 1009
BsaXI	ACNNNNNCTCC	4 cut(s)	45, 75, 185, 215
Bsc4I	CCNNNNNNNGG	5 cut(s)	12, 210, 255, 601, 893
Bse1I	ACTGG	4 cut(s)	224, 671, 845, 1208
BseAI	TCCGGA	1 cut(s)	1009
BseGI	GGATG	1 cut(s)	1263
BseLI	CCNNNNNNNGG	5 cut(s)	12, 210, 255, 601, 893
BseMII	CTCAG	2 cut(s)	774, 914
BseNI	ACTGG	4 cut(s)	224, 671, 845, 1208
BseRI	GAGGAG	1 cut(s)	193
BseSI	GKGCMC	2 cut(s)	248, 491
BseXI	GCAGC	4 cut(s)	1024, 1043, 1081, 1103
BseYI	CCCAGC	1 cut(s)	1097
BsgI	GTGCAG	1 cut(s)	1110
BshFI	GGCC	2 cut(s)	489, 1049
BshNI	GGYRCC	1 cut(s)	245
BsiHKAI	GWGCWC	1 cut(s)	219
BsiSI	CCGG	3 cut(s)	381, 748, 1010
BslFI	GGGAC	2 cut(s)	764, 1258
BslI	CCNNNNNNNGG	5 cut(s)	12, 210, 255, 601, 893
BsmAI	GTCTC	3 cut(s)	549, 596, 1191
BsmBI	CGTCTC	1 cut(s)	1191
BsmFI	GGGAC	2 cut(s)	764, 1258
BsnI	GGCC	2 cut(s)	489, 1049
Bsp120I	GGGCCC	1 cut(s)	487
Bsp1286I	GDGCHC	4 cut(s)	219, 248, 322, 491
Bsp13I	TCCGGA	1 cut(s)	1009
Bsp1407I	TGTACA	1 cut(s)	879
Bsp143I	GATC	2 cut(s)	762, 955
BspACI	CCGC	5 cut(s)	485, 648, 894, 1035, 1103
BspANI	GGCC	2 cut(s)	489, 1049
BspCNI	CTCAG	2 cut(s)	775, 913
BspEI	TCCGGA	1 cut(s)	1009
BspLI	GGNNCC	4 cut(s)	55, 247, 489, 780
BspT107I	GGYRCC	1 cut(s)	245
BsrGI	TGTACA	1 cut(s)	879
BsrI	ACTGG	4 cut(s)	224, 671, 845, 1208
BssMI	GATC	2 cut(s)	762, 955
Bst4CI	ACNGT	2 cut(s)	572, 663
BstAPI	GCANNNNNTGC	1 cut(s)	1037
BstAUI	TGTACA	1 cut(s)	879
BstBAI	YACGTR	1 cut(s)	33
BstC8I	GCNNGC	5 cut(s)	58, 487, 846, 1219, 1223
BstDEI	CTNAG	4 cut(s)	497, 783, 900, 1190
BstF5I	GGATG	1 cut(s)	1263
BstH2I	RGCGCY	1 cut(s)	742
BstHHI	GCGC	2 cut(s)	288, 741
BstKTI	GATC	2 cut(s)	765, 958
BstMAI	GTCTC	3 cut(s)	549, 596, 1191
BstMBI	GATC	2 cut(s)	762, 955
BstMWI	GCNNNNNNNGC	5 cut(s)	294, 1037, 1046, 1055, 1100
BstNSI	RCATGY	4 cut(s)	655, 848, 996, 1225
BstSLI	GKGCMC	2 cut(s)	248, 491
BstV1I	GCAGC	4 cut(s)	1024, 1043, 1081, 1103
BsuI	GTATCC	1 cut(s)	185
BsuRI	GGCC	2 cut(s)	489, 1049
BtsCI	GGATG	1 cut(s)	1263
BtsIMutI	CAGTG	3 cut(s)	93, 217, 758
Cac8I	GCNNGC	5 cut(s)	58, 487, 846, 1219, 1223
CaiI	CAGNNNCTG	2 cut(s)	1037, 1097
CfoI	GCGC	2 cut(s)	288, 741
Cfr13I	GGNCC	4 cut(s)	487, 488, 778, 1154
CseI	GACGC	1 cut(s)	49
Csp6I	GTAC	5 cut(s)	34, 127, 568, 880, 1284
CviQI	GTAC	5 cut(s)	34, 127, 568, 880, 1284
DdeI	CTNAG	4 cut(s)	497, 783, 900, 1190
DpnI	GATC	2 cut(s)	764, 957
DpnII	GATC	2 cut(s)	762, 955
DraI	TTTAAA	1 cut(s)	705
Eco24I	GRGCYC	2 cut(s)	322, 491
Eco47I	GGWCC	2 cut(s)	778, 1154
Eco57I	CTGAAG	1 cut(s)	69
EcoO109I	RGGNCCY	1 cut(s)	778
EcoT38I	GRGCYC	2 cut(s)	322, 491
Esp3I	CGTCTC	1 cut(s)	1191
FaqI	GGGAC	2 cut(s)	764, 1258
FauI	CCCGC	1 cut(s)	478
FauNDI	CATATG	1 cut(s)	466
Fnu4HI	GCNGC	7 cut(s)	649, 895, 1032, 1035, 1038, 1092, 1095
FokI	GGATG	1 cut(s)	1250
FriOI	GRGCYC	2 cut(s)	322, 491
Fsp4HI	GCNGC	7 cut(s)	649, 895, 1032, 1035, 1038, 1092, 1095
FspBI	CTAG	1 cut(s)	959
FspI	TGCGCA	1 cut(s)	287
GlaI	GCGC	2 cut(s)	287, 740
GluI	GCNGC	7 cut(s)	649, 895, 1032, 1035, 1038, 1092, 1095
GsaI	CCCAGC	1 cut(s)	1101
GsuI	CTGGAG	1 cut(s)	166
HaeII	RGCGCY	1 cut(s)	742
HaeIII	GGCC	2 cut(s)	489, 1049
HapII	CCGG	3 cut(s)	381, 748, 1010
HgaI	GACGC	1 cut(s)	49
HhaI	GCGC	2 cut(s)	288, 741
Hin6I	GCGC	2 cut(s)	286, 739
HinP1I	GCGC	2 cut(s)	286, 739
HindIII	AAGCTT	6 cut(s)	295, 499, 826, 908, 968, 1250
HinfI	GANTC	1 cut(s)	329
HpaII	CCGG	3 cut(s)	381, 748, 1010
Hpy166II	GTNNAC	1 cut(s)	805
Hpy188I	TCNGA	3 cut(s)	600, 732, 903
Hpy188III	TCNNGA	6 cut(s)	145, 326, 421, 959, 1010, 1079
Hpy8I	GTNNAC	1 cut(s)	805
HpyAV	CCTTC	2 cut(s)	605, 646
HpyCH4III	ACNGT	2 cut(s)	572, 663
HpyCH4IV	ACGT	1 cut(s)	32
HpyCH4V	TGCA	8 cut(s)	49, 174, 366, 470, 1040, 1091, 1130, 1274
HpyF10VI	GCNNNNNNNGC	5 cut(s)	294, 1037, 1046, 1055, 1100
HpyF3I	CTNAG	4 cut(s)	497, 783, 900, 1190
HpySE526I	ACGT	1 cut(s)	32
HspAI	GCGC	2 cut(s)	286, 739
Kpn2I	TCCGGA	1 cut(s)	1009
Kzo9I	GATC	2 cut(s)	762, 955
LmnI	GCTCC	2 cut(s)	53, 214
Lsp1109I	GCAGC	4 cut(s)	1024, 1043, 1081, 1103
LweI	GCATC	1 cut(s)	1261
MaeI	CTAG	1 cut(s)	959
MaeII	ACGT	1 cut(s)	32
MaeIII	GTNAC	4 cut(s)	392, 402, 756, 1105
MalI	GATC	2 cut(s)	764, 957
MboI	GATC	2 cut(s)	762, 955
MboII	GAAGA	4 cut(s)	151, 158, 847, 1012
MfeI	CAATTG	1 cut(s)	808
MhlI	GDGCHC	4 cut(s)	219, 248, 322, 491
MluCI	AATT	7 cut(s)	91, 261, 492, 541, 808, 1082, 1184
MroI	TCCGGA	1 cut(s)	1009
MroXI	GAANNNNTTC	1 cut(s)	128
MseI	TTAA	2 cut(s)	270, 704
MslI	CAYNNNNRTG	2 cut(s)	982, 1266
MspA1I	CMGCKG	4 cut(s)	523, 648, 1037, 1094
MspI	CCGG	3 cut(s)	381, 748, 1010
MunI	CAATTG	1 cut(s)	808
MwoI	GCNNNNNNNGC	5 cut(s)	294, 1037, 1046, 1055, 1100
NdeI	CATATG	1 cut(s)	466
NdeII	GATC	2 cut(s)	762, 955
NlaIV	GGNNCC	4 cut(s)	55, 247, 489, 780
NmuCI	GTSAC	1 cut(s)	756
NsbI	TGCGCA	1 cut(s)	287
NspI	RCATGY	4 cut(s)	655, 848, 996, 1225
OliI	CACNNNNGTG	1 cut(s)	1266
PaeI	GCATGC	2 cut(s)	848, 1225
PdmI	GAANNNNTTC	1 cut(s)	128
PfeI	GAWTC	1 cut(s)	329
PflMI	CCANNNNNTGG	1 cut(s)	12
PkrI	GCNGC	7 cut(s)	650, 896, 1033, 1036, 1039, 1093, 1096
Ppu21I	YACGTR	1 cut(s)	33
PpuMI	RGGWCCY	1 cut(s)	778
Psp5II	RGGWCCY	1 cut(s)	778
PspFI	CCCAGC	1 cut(s)	1097
PspN4I	GGNNCC	4 cut(s)	55, 247, 489, 780
PspOMI	GGGCCC	1 cut(s)	487
PspPI	GGNCC	4 cut(s)	487, 488, 778, 1154
PspPPI	RGGWCCY	1 cut(s)	778
PstNI	CAGNNNCTG	2 cut(s)	1037, 1097
PvuII	CAGCTG	2 cut(s)	523, 1094
RsaI	GTAC	5 cut(s)	35, 128, 569, 881, 1285
RsaNI	GTAC	5 cut(s)	34, 127, 568, 880, 1284
RseI	CAYNNNNRTG	2 cut(s)	982, 1266
SaqAI	TTAA	2 cut(s)	270, 704
SatI	GCNGC	7 cut(s)	649, 895, 1032, 1035, 1038, 1092, 1095
Sau3AI	GATC	2 cut(s)	762, 955
Sau96I	GGNCC	4 cut(s)	487, 488, 778, 1154
ScaI	AGTACT	1 cut(s)	128
SduI	GDGCHC	4 cut(s)	219, 248, 322, 491
SfaNI	GCATC	1 cut(s)	1261
SinI	GGWCC	2 cut(s)	778, 1154
SmiMI	CAYNNNNRTG	2 cut(s)	982, 1266
SphI	GCATGC	2 cut(s)	848, 1225
Sse9I	AATT	7 cut(s)	91, 261, 492, 541, 808, 1082, 1184
SsiI	CCGC	5 cut(s)	485, 648, 894, 1035, 1103
SspI	AATATT	1 cut(s)	370
SspMI	CTAG	1 cut(s)	959
TaaI	ACNGT	2 cut(s)	572, 663
TaiI	ACGT	1 cut(s)	35
TaqI	TCGA	2 cut(s)	118, 339
TasI	AATT	7 cut(s)	91, 261, 492, 541, 808, 1082, 1184
TatI	WGTACW	2 cut(s)	126, 879
TauI	GCSGC	3 cut(s)	651, 897, 1037
TfiI	GAWTC	1 cut(s)	329
Tru1I	TTAA	2 cut(s)	270, 704
Tru9I	TTAA	2 cut(s)	270, 704
TscAI	CASTG	3 cut(s)	93, 224, 765
TseFI	GTSAC	1 cut(s)	756
TseI	GCWGC	4 cut(s)	1031, 1037, 1091, 1094
Tsp45I	GTSAC	1 cut(s)	756
TspDTI	ATGAA	3 cut(s)	15, 321, 966
TspGWI	ACGGA	2 cut(s)	1215, 1256
TspRI	CASTG	3 cut(s)	93, 224, 765
Van91I	CCANNNNNTGG	1 cut(s)	12
VpaK11BI	GGWCC	2 cut(s)	778, 1154
XapI	RAATTY	3 cut(s)	91, 261, 1082
XbaI	TCTAGA	1 cut(s)	958
XceI	RCATGY	4 cut(s)	655, 848, 996, 1225
XmnI	GAANNNNTTC	1 cut(s)	128
XspI	CTAG	1 cut(s)	959
ZrmI	AGTACT	1 cut(s)	128

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.