Rmu_sc0028741.1_g000001

Spermatogenesis-associated protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028741.1
OG0012290
Physical Location & Seq
Forward (+)
1 .. 2359
2359 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028741.1_g000001.1.cds

Sequence Viewer

Length: 1186 bp
tgattcaaagtttggtgggtttggatctgccccaaagtttcctagaccagttgagattcagctgatgctttattactcaaagaagtcggaggaaactgtaaattctggcaaggccaatgaagttctgaaaaaggttctgtttaccttgcaatgcatggcaaaagggggaattcacgatcacgtcggaggtggcttccaccgatatagcgtggatgagtgctggcatgtaccgcactttgagaagatgttgtatgatcagggccaacttgctaatgtctacctagatgccttttctattgccaaagatgtattctatgcatctattgctcgggatgttcttgattatctgaggagagacatgattggaccagatggcgaaatatattcagcagaagatgctgacagtgctgaatctgaaggtgcatccagaaaaaaggaaggagcattctatgtttggtctagcaaagaggttgaagacatacttggagaagatgcaactctttttaagaaccactactatataaagccttccggtaactgtgacctttccagaataagtgatcctcataatgaattcaagaggaagaatgtgctgattgagagaaaaagtcattccgaggcatcaaaattttccatgccggttgagaaatacctcgacattctgggtcagagcaggcgaaagctttttgaaataagatgtagtcgaccaagaccacatttggatgataaggtaattgtagcatggaatggactggccatctcagcctttgcaagagcctctaaaattctaaagaatgaacctaaggagatcaagttcaactttcctgttgttggttgtgatccgcgggagtacattgaagttgcagaaaaggcagcatcttttatcaggcgacacctttacaatgaacaatctcatcgactgcaacgcagctttaggaacggcccatctaaagcacctggatttttagatgattatgcttttcttatttcagggttattggatctttatgaatttggtgatgaccctagtgttctccttcgtgtgaaggaagatcatgatggggcagagccctctggaaattcggtttctgtgatcaaccttgtgagattggcatcaatactatctggcaacaggtctgagcattacagacaggaagctgaacatgttctggttcgtgatgtataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00240 ko01100 map00240 map01100
Pfam Domains
Protein Families
Thioredox_DsbH

Protein Analysis

394

Amino Acids

44.71

Weight (kDa)

6.43

Isoelectric Point (pI)

52.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012290)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G03200 AT4G03200
fragaria_vesca FvH4_2g25030
malus_domestica MD03G1280600.v1.1
prunus_persica Prupe.8G255100_v2.0.a1
pyrus_communis pycom03g22230
rosa_chinensis RchiOBHm_Chr6g0293001
rosa_laevigata RLG00000011975
rosa_multiflora Rmu_sc0001788.1_g000005 Rmu_sc0003615.1_g000002 Rmu_sc0028741.1_g000001
rosa_roxburghii Rroxscaffold_7G00174480
rosa_rugosa Rorug06G0231900 Rorug06G0232000
rosa_samantha Rh6AG344700 Rh6BG352100 Rh6CG359300 Rh6DG344800
rosa_wichuraiana Rw6G030080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 277, 704
AccII CGCG 1 cut(s) 845
AciI CCGC 3 cut(s) 231, 843, 845
AclWI GGATC 4 cut(s) 32, 555, 834, 1009
AcoI YGGCCR 1 cut(s) 754
AcsI RAATTY 7 cut(s) 101, 169, 573, 627, 784, 1011, 1079
AcuI CTGAAG 1 cut(s) 436
AfaI GTAC 2 cut(s) 229, 852
AfiI CCNNNNNNNGG 1 cut(s) 831
AflIII ACRYGT 1 cut(s) 1163
AgsI TTSAA 6 cut(s) 7, 474, 578, 690, 818, 858
AjiI CACGTC 1 cut(s) 182
AjnI CCWGG 1 cut(s) 956
AjuI GAANNNNNNNTTGG 4 cut(s) 294, 326, 466, 498
AloI GAACNNNNNNTCC 2 cut(s) 798, 830
AluBI AGCT 4 cut(s) 62, 683, 931, 1158
AluI AGCT 4 cut(s) 62, 683, 931, 1158
Alw26I GTCTC 1 cut(s) 349
AlwI GGATC 4 cut(s) 32, 555, 834, 1009
Ama87I CYCGRG 1 cut(s) 328
AoxI GGCC 4 cut(s) 112, 260, 754, 941
ApeKI GCWGC 2 cut(s) 873, 928
ApoI RAATTY 7 cut(s) 101, 169, 573, 627, 784, 1011, 1079
Asp700I GAANNNNTTC 1 cut(s) 1165
AspS9I GGNCC 3 cut(s) 260, 366, 942
AsuHPI GGTGA 1 cut(s) 1029
AvaI CYCGRG 1 cut(s) 328
AvaII GGWCC 1 cut(s) 366
AxyI CCTNAGG 1 cut(s) 802
BalI TGGCCA 1 cut(s) 756
BanII GRGCYC 1 cut(s) 1072
BbsI GAAGAC 1 cut(s) 481
BbvI GCAGC 2 cut(s) 885, 940
BccI CCATC 4 cut(s) 366, 765, 953, 1053
BceAI ACGGC 1 cut(s) 956
BciT130I CCWGG 1 cut(s) 958
BclI TGATCA 2 cut(s) 254, 1093
BcoDI GTCTC 1 cut(s) 349
BfaI CTAG 4 cut(s) 43, 282, 460, 1027
BisI GCNGC 2 cut(s) 874, 929
BlsI GCNGC 2 cut(s) 875, 930
Bme1390I CCNGG 1 cut(s) 958
Bme18I GGWCC 1 cut(s) 366
BmeT110I CYCGRG 1 cut(s) 328
BmgBI CACGTC 1 cut(s) 182
BmgT120I GGNCC 3 cut(s) 260, 366, 942
BmrFI CCNGG 1 cut(s) 958
BmsI GCATC 9 cut(s) 55, 275, 327, 386, 432, 482, 630, 885, 1122
BpiI GAAGAC 1 cut(s) 481
BsaBI GATNNNNATC 1 cut(s) 1112
BsaJI CCNNGG 2 cut(s) 616, 843
BsaWI WCCGGW 1 cut(s) 531
BsaXI ACNNNNNCTCC 2 cut(s) 798, 828
Bsc4I CCNNNNNNNGG 1 cut(s) 831
Bse118I RCCGGY 1 cut(s) 638
Bse1I ACTGG 2 cut(s) 48, 757
Bse21I CCTNAGG 1 cut(s) 802
Bse3DI GCAATG 1 cut(s) 156
Bse8I GATNNNNATC 1 cut(s) 1112
BseBI CCWGG 1 cut(s) 958
BseDI CCNNGG 2 cut(s) 616, 843
BseGI GGATG 4 cut(s) 218, 338, 423, 728
BseJI GATNNNNATC 1 cut(s) 1112
BseLI CCNNNNNNNGG 1 cut(s) 831
BseMI GCAATG 1 cut(s) 156
BseMII CTCAG 3 cut(s) 339, 775, 1129
BseNI ACTGG 2 cut(s) 48, 757
BseRI GAGGAG 1 cut(s) 365
BseXI GCAGC 2 cut(s) 885, 940
Bsh1236I CGCG 1 cut(s) 845
BshFI GGCC 4 cut(s) 114, 262, 756, 943
BsiHKCI CYCGRG 1 cut(s) 328
BsiSI CCGG 2 cut(s) 532, 639
BslI CCNNNNNNNGG 1 cut(s) 831
BsmAI GTCTC 1 cut(s) 349
BsmI GAATGC 1 cut(s) 444
BsnI GGCC 4 cut(s) 114, 262, 756, 943
BsoBI CYCGRG 1 cut(s) 328
Bsp1286I GDGCHC 1 cut(s) 1072
Bsp143I GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
BspACI CCGC 3 cut(s) 231, 843, 845
BspANI GGCC 4 cut(s) 114, 262, 756, 943
BspCNI CTCAG 3 cut(s) 340, 774, 1130
BspFNI CGCG 1 cut(s) 845
BspHI TCATGA 1 cut(s) 1055
BspPI GGATC 4 cut(s) 32, 555, 834, 1009
BsrDI GCAATG 1 cut(s) 156
BsrFI RCCGGY 1 cut(s) 638
BsrI ACTGG 2 cut(s) 48, 757
BssAI RCCGGY 1 cut(s) 638
BssECI CCNNGG 2 cut(s) 616, 843
BssMI GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
Bst2UI CCWGG 1 cut(s) 958
Bst4CI ACNGT 3 cut(s) 98, 405, 540
BstAPI GCANNNNNTGC 2 cut(s) 324, 396
BstC8I GCNNGC 2 cut(s) 222, 675
BstDEI CTNAG 4 cut(s) 348, 761, 802, 1138
BstDSI CCRYGG 1 cut(s) 843
BstF5I GGATG 4 cut(s) 218, 338, 423, 728
BstFNI CGCG 1 cut(s) 845
BstKTI GATC 9 cut(s) 27, 179, 257, 563, 811, 842, 1004, 1055, 1096
BstMAI GTCTC 1 cut(s) 349
BstMBI GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
BstMWI GCNNNNNNNGC 6 cut(s) 230, 324, 396, 405, 762, 870
BstNI CCWGG 1 cut(s) 958
BstNSI RCATGY 2 cut(s) 228, 1167
BstSCI CCNGG 1 cut(s) 956
BstUI CGCG 1 cut(s) 845
BstV1I GCAGC 2 cut(s) 885, 940
BstV2I GAAGAC 1 cut(s) 481
BstX2I RGATCY 2 cut(s) 24, 1001
BstYI RGATCY 2 cut(s) 24, 1001
Bsu36I CCTNAGG 1 cut(s) 802
BsuRI GGCC 4 cut(s) 114, 262, 756, 943
BtgI CCRYGG 1 cut(s) 843
BtrI CACGTC 1 cut(s) 182
BtsCI GGATG 4 cut(s) 218, 338, 423, 728
BtsIMutI CAGTG 1 cut(s) 410
Cac8I GCNNGC 2 cut(s) 222, 675
CciI TCATGA 1 cut(s) 1055
Cfr10I RCCGGY 1 cut(s) 638
Cfr13I GGNCC 3 cut(s) 260, 366, 942
Cfr42I CCGCGG 1 cut(s) 846
Csp6I GTAC 2 cut(s) 228, 851
CviAII CATG 7 cut(s) 155, 225, 359, 635, 742, 1056, 1164
CviQI GTAC 2 cut(s) 228, 851
DdeI CTNAG 4 cut(s) 348, 761, 802, 1138
DpnI GATC 9 cut(s) 26, 178, 256, 562, 810, 841, 1003, 1054, 1095
DpnII GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
EaeI YGGCCR 1 cut(s) 754
Eco24I GRGCYC 1 cut(s) 1072
Eco47I GGWCC 1 cut(s) 366
Eco57I CTGAAG 1 cut(s) 436
Eco81I CCTNAGG 1 cut(s) 802
Eco88I CYCGRG 1 cut(s) 328
EcoRI GAATTC 2 cut(s) 169, 573
EcoRII CCWGG 1 cut(s) 956
EcoT22I ATGCAT 2 cut(s) 156, 320
EcoT38I GRGCYC 1 cut(s) 1072
FaeI CATG 7 cut(s) 158, 228, 362, 638, 745, 1059, 1167
FalI AAGNNNNNCTT 4 cut(s) 466, 498, 804, 836
FatI CATG 7 cut(s) 154, 224, 358, 634, 741, 1055, 1163
FauI CCCGC 1 cut(s) 838
FbaI TGATCA 2 cut(s) 254, 1093
FblI GTMKAC 2 cut(s) 277, 704
Fnu4HI GCNGC 2 cut(s) 874, 929
FokI GGATG 4 cut(s) 225, 345, 410, 735
FriOI GRGCYC 1 cut(s) 1072
Fsp4HI GCNGC 2 cut(s) 874, 929
FspBI CTAG 4 cut(s) 43, 282, 460, 1027
GluI GCNGC 2 cut(s) 874, 929
HaeIII GGCC 4 cut(s) 114, 262, 756, 943
HapII CCGG 2 cut(s) 532, 639
Hin1II CATG 7 cut(s) 158, 228, 362, 638, 745, 1059, 1167
HincII GTYRAC 1 cut(s) 705
HindII GTYRAC 1 cut(s) 705
HindIII AAGCTT 1 cut(s) 681
HinfI GANTC 3 cut(s) 3, 56, 411
HpaII CCGG 2 cut(s) 532, 639
HphI GGTGA 1 cut(s) 1029
Hpy166II GTNNAC 3 cut(s) 142, 278, 705
Hpy188I TCNGA 8 cut(s) 89, 127, 186, 349, 416, 617, 670, 1139
Hpy188III TCNNGA 9 cut(s) 174, 330, 339, 427, 550, 578, 1056, 1075, 1176
Hpy8I GTNNAC 3 cut(s) 142, 278, 705
Hpy99I CGWCG 1 cut(s) 186
HpyAV CCTTC 5 cut(s) 411, 432, 538, 1040, 1047
HpyCH4III ACNGT 3 cut(s) 98, 405, 540
HpyCH4IV ACGT 1 cut(s) 181
HpyCH4V TGCA 8 cut(s) 149, 154, 318, 423, 495, 771, 864, 923
HpyF10VI GCNNNNNNNGC 6 cut(s) 230, 324, 396, 405, 762, 870
HpyF3I CTNAG 4 cut(s) 348, 761, 802, 1138
HpySE526I ACGT 1 cut(s) 181
Hsp92II CATG 7 cut(s) 158, 228, 362, 638, 745, 1059, 1167
Ksp22I TGATCA 2 cut(s) 254, 1093
KspI CCGCGG 1 cut(s) 846
Kzo9I GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
LmnI GCTCC 1 cut(s) 441
Lsp1109I GCAGC 2 cut(s) 885, 940
LweI GCATC 9 cut(s) 55, 275, 327, 386, 432, 482, 630, 885, 1122
MaeI CTAG 4 cut(s) 43, 282, 460, 1027
MaeII ACGT 1 cut(s) 181
MaeIII GTNAC 2 cut(s) 534, 540
MalI GATC 9 cut(s) 26, 178, 256, 562, 810, 841, 1003, 1054, 1095
MboI GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
MboII GAAGA 6 cut(s) 254, 405, 486, 501, 596, 1062
MflI RGATCY 2 cut(s) 24, 1001
MhlI GDGCHC 1 cut(s) 1072
MlsI TGGCCA 1 cut(s) 756
MluCI AATT 8 cut(s) 101, 169, 573, 627, 733, 784, 1011, 1079
MluNI TGGCCA 1 cut(s) 756
MmeI TCCRAC 2 cut(s) 67, 164
Mox20I TGGCCA 1 cut(s) 756
Mph1103I ATGCAT 2 cut(s) 156, 320
MroXI GAANNNNTTC 1 cut(s) 1165
MscI TGGCCA 1 cut(s) 756
MseI TTAA 1 cut(s) 505
MslI CAYNNNNRTG 1 cut(s) 721
Msp20I TGGCCA 1 cut(s) 756
MspA1I CMGCKG 2 cut(s) 62, 845
MspI CCGG 2 cut(s) 532, 639
MspR9I CCNGG 1 cut(s) 958
Mva1269I GAATGC 1 cut(s) 444
MvaI CCWGG 1 cut(s) 958
MvnI CGCG 1 cut(s) 845
MwoI GCNNNNNNNGC 6 cut(s) 230, 324, 396, 405, 762, 870
NdeII GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
NlaIII CATG 7 cut(s) 158, 228, 362, 638, 745, 1059, 1167
NmuCI GTSAC 1 cut(s) 540
NsiI ATGCAT 2 cut(s) 156, 320
NspI RCATGY 2 cut(s) 228, 1167
PagI TCATGA 1 cut(s) 1055
PciI ACATGT 1 cut(s) 1163
PctI GAATGC 1 cut(s) 444
PdmI GAANNNNTTC 1 cut(s) 1165
PfeI GAWTC 3 cut(s) 3, 56, 411
PkrI GCNGC 2 cut(s) 875, 930
PscI ACATGT 1 cut(s) 1163
Psp6I CCWGG 1 cut(s) 956
PspGI CCWGG 1 cut(s) 956
PspPI GGNCC 3 cut(s) 260, 366, 942
PsuI RGATCY 2 cut(s) 24, 1001
PvuII CAGCTG 1 cut(s) 62
RsaI GTAC 2 cut(s) 229, 852
RsaNI GTAC 2 cut(s) 228, 851
RseI CAYNNNNRTG 1 cut(s) 721
SacII CCGCGG 1 cut(s) 846
SalI GTCGAC 1 cut(s) 703
SaqAI TTAA 1 cut(s) 505
SatI GCNGC 2 cut(s) 874, 929
Sau3AI GATC 9 cut(s) 24, 176, 254, 560, 808, 839, 1001, 1052, 1093
Sau96I GGNCC 3 cut(s) 260, 366, 942
ScrFI CCNGG 1 cut(s) 958
SduI GDGCHC 1 cut(s) 1072
SfaNI GCATC 9 cut(s) 55, 275, 327, 386, 432, 482, 630, 885, 1122
Sfr303I CCGCGG 1 cut(s) 846
SgrBI CCGCGG 1 cut(s) 846
SinI GGWCC 1 cut(s) 366
SmiMI CAYNNNNRTG 1 cut(s) 721
Sse9I AATT 8 cut(s) 101, 169, 573, 627, 733, 784, 1011, 1079
SsiI CCGC 3 cut(s) 231, 843, 845
SspMI CTAG 4 cut(s) 43, 282, 460, 1027
StyD4I CCNGG 1 cut(s) 956
TaaI ACNGT 3 cut(s) 98, 405, 540
TaiI ACGT 1 cut(s) 184
TaqI TCGA 3 cut(s) 655, 704, 917
TasI AATT 8 cut(s) 101, 169, 573, 627, 733, 784, 1011, 1079
TatI WGTACW 1 cut(s) 850
TfiI GAWTC 3 cut(s) 3, 56, 411
Tru1I TTAA 1 cut(s) 505
Tru9I TTAA 1 cut(s) 505
TscAI CASTG 1 cut(s) 410
TseFI GTSAC 1 cut(s) 540
TseI GCWGC 2 cut(s) 873, 928
Tsp45I GTSAC 1 cut(s) 540
TspDTI ATGAA 5 cut(s) 133, 586, 811, 919, 1024
TspRI CASTG 1 cut(s) 410
VpaK11BI GGWCC 1 cut(s) 366
XapI RAATTY 7 cut(s) 101, 169, 573, 627, 784, 1011, 1079
XceI RCATGY 2 cut(s) 228, 1167
XmiI GTMKAC 2 cut(s) 277, 704
XmnI GAANNNNTTC 1 cut(s) 1165
XspI CTAG 4 cut(s) 43, 282, 460, 1027
Zsp2I ATGCAT 2 cut(s) 156, 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.