Rmu_sc0029706.1_g000003

Root cap

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0029706.1
Physical Location & Seq
Reverse (-)
5266 .. 6852
1587 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0029706.1_g000003.1.cds

Sequence Viewer

Length: 1296 bp
atggctaaactgagagtgtcttttgtgttggtggctgtcgctgtggtgcttattgccatggaagccagctctgttctgggtcaaggcagtggaaacggaaatgggaatgggaatggcaacactggcagtggcaatggaaatgggaacggcaatggcaacactggcagtggcaacgggaatgggaacggcaatggcaacactggcagtggcaacgggaatgggaacgggaatggcaacactggcagtggcaacggcaacggaaatgggaacggcaacggcaacggaaacggaaatggtaatggcaatggtaacggaaatggcaatggcaacgggaatggtaacggcaatgcaattagtgacagcacgaactacgacgtattgccaccactagcgacgggacaggagcaatgcatgtgcaaagcgcagggagcctgtttctacaagacgcttgtttgtccaccagaatgccccgagagaaagcccaaaaacaacaagaaaaaaaagggttgcttcgttaactgcggaagcaagtgtgaagtcacttgcaaaattagaagaggcaactgtgatggttatggatctatctgctacgaccctcgatttatcggtggtgatggtgtaatgttctacttccatggagtcaagggaggaaactttgccattgtctcggatgaaaaactccacatcaacgcacatttcattgggactcgaccagaaggaaggactcgtgacttcacatggattcaagcaatctcaatcatgttcgacagtcacacccttgttattggagcaaagagggtttccaagtggaatgacaaagttgatgctctcatggtgaagtgggatagtgagtcagttgacatccctgaatatggtggggccgaatggaggactaatggtgaggacagagaggtaatcatcgaaagaaccgatgatgcgaactatgcaagagttacggtctctgatttggtcgacataaccattagggttaggcctattggagaaaaggaagacagggttcatcattaccatataccagttgatgatacttttgctcacttggagacacagttcacattttcgaaattatctgatctggtggaaggagttctagggaagacctataggccaggctatgttagtcgagtcaagagaggagttccaatgccattgatgggtggagaggataagtacaaaactccatcactcttttcacctatctgcaaggtttgtaggtttcaaactactgctcgtcaatctggtgggcttgcaattacaaccggagtggctgcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

431

Amino Acids

45.47

Weight (kDa)

8.48

Isoelectric Point (pI)

9.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 972
AciI CCGC 1 cut(s) 522
AclWI GGATC 1 cut(s) 586
AfaI GTAC 1 cut(s) 1193
AfiI CCNNNNNNNGG 3 cut(s) 872, 888, 1175
AgsI TTSAA 2 cut(s) 746, 1241
AjnI CCWGG 1 cut(s) 1129
AloI GAACNNNNNNTCC 2 cut(s) 1055, 1087
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
Alw26I GTCTC 3 cut(s) 670, 964, 1058
AlwI GGATC 1 cut(s) 586
Ama87I CYCGRG 1 cut(s) 470
AoxI GGCC 3 cut(s) 879, 992, 1127
ApeKI GCWGC 1 cut(s) 1289
Asp700I GAANNNNTTC 1 cut(s) 1107
AspLEI GCGC 1 cut(s) 424
AspS9I GGNCC 1 cut(s) 879
AsuHPI GGTGA 4 cut(s) 623, 847, 911, 1206
AsuII TTCGAA 1 cut(s) 1082
AvaI CYCGRG 1 cut(s) 470
BauI CACGAG 1 cut(s) 726
BbsI GAAGAC 2 cut(s) 1017, 1124
BbvI GCAGC 1 cut(s) 1276
BccI CCATC 4 cut(s) 563, 608, 1168, 1210
BceAI ACGGC 6 cut(s) 163, 202, 268, 286, 292, 358
BciT130I CCWGG 1 cut(s) 1131
BcoDI GTCTC 3 cut(s) 670, 964, 1058
BfaI CTAG 2 cut(s) 389, 1112
BfmI CTRYAG 1 cut(s) 1123
BisI GCNGC 1 cut(s) 1290
BlsI GCNGC 1 cut(s) 1291
Bme1390I CCNGG 1 cut(s) 1131
BmeT110I CYCGRG 1 cut(s) 470
BmgT120I GGNCC 1 cut(s) 879
BmiI GGNNCC 2 cut(s) 430, 880
BmrFI CCNGG 1 cut(s) 1131
BmsI GCATC 2 cut(s) 814, 925
BpiI GAAGAC 2 cut(s) 1017, 1124
Bpu14I TTCGAA 1 cut(s) 1082
BsaI GGTCTC 1 cut(s) 964
BsaJI CCNNGG 2 cut(s) 57, 634
BsaWI WCCGGW 1 cut(s) 1280
BsaXI ACNNNNNCTCC 2 cut(s) 1055, 1085
Bsc4I CCNNNNNNNGG 3 cut(s) 872, 888, 1175
Bse1I ACTGG 5 cut(s) 127, 166, 205, 244, 1037
Bse3DI GCAATG 7 cut(s) 139, 157, 196, 310, 328, 352, 413
BseBI CCWGG 1 cut(s) 1131
BseDI CCNNGG 2 cut(s) 57, 634
BseGI GGATG 2 cut(s) 676, 861
BseLI CCNNNNNNNGG 3 cut(s) 872, 888, 1175
BseMI GCAATG 7 cut(s) 139, 157, 196, 310, 328, 352, 413
BseNI ACTGG 5 cut(s) 127, 166, 205, 244, 1037
BseRI GAGGAG 1 cut(s) 1170
BseXI GCAGC 1 cut(s) 1276
BshFI GGCC 3 cut(s) 881, 994, 1129
BsiHKCI CYCGRG 1 cut(s) 470
BsiSI CCGG 1 cut(s) 1281
BslFI GGGAC 2 cut(s) 411, 718
BslI CCNNNNNNNGG 3 cut(s) 872, 888, 1175
BsmAI GTCTC 3 cut(s) 670, 964, 1058
BsmFI GGGAC 2 cut(s) 411, 718
BsmI GAATGC 1 cut(s) 470
BsnI GGCC 3 cut(s) 881, 994, 1129
Bso31I GGTCTC 1 cut(s) 964
BsoBI CYCGRG 1 cut(s) 470
Bsp119I TTCGAA 1 cut(s) 1082
Bsp143I GATC 2 cut(s) 578, 1093
Bsp19I CCATGG 2 cut(s) 57, 634
BspACI CCGC 1 cut(s) 522
BspANI GGCC 3 cut(s) 881, 994, 1129
BspLI GGNNCC 2 cut(s) 430, 880
BspPI GGATC 1 cut(s) 586
BspT104I TTCGAA 1 cut(s) 1082
BspTNI GGTCTC 1 cut(s) 964
BsrDI GCAATG 7 cut(s) 139, 157, 196, 310, 328, 352, 413
BsrI ACTGG 5 cut(s) 127, 166, 205, 244, 1037
BssECI CCNNGG 2 cut(s) 57, 634
BssMI GATC 2 cut(s) 578, 1093
BssSI CACGAG 1 cut(s) 726
BssT1I CCWWGG 2 cut(s) 57, 634
Bst2BI CACGAG 1 cut(s) 726
Bst2UI CCWGG 1 cut(s) 1131
Bst4CI ACNGT 4 cut(s) 566, 770, 958, 1071
Bst6I CTCTTC 1 cut(s) 550
BstBI TTCGAA 1 cut(s) 1082
BstC8I GCNNGC 2 cut(s) 67, 1269
BstDEI CTNAG 1 cut(s) 11
BstDSI CCRYGG 2 cut(s) 57, 634
BstF5I GGATG 2 cut(s) 676, 861
BstHHI GCGC 1 cut(s) 424
BstKTI GATC 2 cut(s) 581, 1096
BstMAI GTCTC 3 cut(s) 670, 964, 1058
BstMBI GATC 2 cut(s) 578, 1093
BstMWI GCNNNNNNNGC 7 cut(s) 62, 123, 162, 201, 240, 428, 944
BstNI CCWGG 1 cut(s) 1131
BstNSI RCATGY 1 cut(s) 415
BstSCI CCNGG 1 cut(s) 1129
BstSFI CTRYAG 1 cut(s) 1123
BstV1I GCAGC 1 cut(s) 1276
BstV2I GAAGAC 2 cut(s) 1017, 1124
BstX2I RGATCY 1 cut(s) 578
BstYI RGATCY 1 cut(s) 578
BsuRI GGCC 3 cut(s) 881, 994, 1129
BtgI CCRYGG 2 cut(s) 57, 634
BtsCI GGATG 2 cut(s) 676, 861
BtsI GCAGTG 5 cut(s) 94, 133, 172, 211, 250
BtsIMutI CAGTG 9 cut(s) 94, 120, 133, 159, 172, 198, 211, 237, 250
Cac8I GCNNGC 2 cut(s) 67, 1269
CfoI GCGC 1 cut(s) 424
Cfr13I GGNCC 1 cut(s) 879
CseI GACGC 1 cut(s) 454
Csp6I GTAC 1 cut(s) 1192
CspCI CAANNNNNGTGG 1 cut(s) 1266
CviAII CATG 6 cut(s) 58, 412, 635, 738, 760, 832
CviQI GTAC 1 cut(s) 1192
DdeI CTNAG 1 cut(s) 11
DpnI GATC 2 cut(s) 580, 1095
DpnII GATC 2 cut(s) 578, 1093
Eam1104I CTCTTC 1 cut(s) 550
EarI CTCTTC 1 cut(s) 550
Eco130I CCWWGG 2 cut(s) 57, 634
Eco147I AGGCCT 1 cut(s) 994
Eco31I GGTCTC 1 cut(s) 964
Eco88I CYCGRG 1 cut(s) 470
EcoRII CCWGG 1 cut(s) 1129
EcoT14I CCWWGG 2 cut(s) 57, 634
EcoT22I ATGCAT 1 cut(s) 413
ErhI CCWWGG 2 cut(s) 57, 634
FaeI CATG 6 cut(s) 61, 415, 638, 741, 763, 835
FalI AAGNNNNNCTT 2 cut(s) 494, 526
FaqI GGGAC 2 cut(s) 411, 718
FatI CATG 6 cut(s) 57, 411, 634, 737, 759, 831
FblI GTMKAC 1 cut(s) 972
Fnu4HI GCNGC 1 cut(s) 1290
FokI GGATG 2 cut(s) 683, 848
Fsp4HI GCNGC 1 cut(s) 1290
FspBI CTAG 2 cut(s) 389, 1112
GlaI GCGC 1 cut(s) 423
GluI GCNGC 1 cut(s) 1290
HaeIII GGCC 3 cut(s) 881, 994, 1129
HapII CCGG 1 cut(s) 1281
HgaI GACGC 1 cut(s) 454
HhaI GCGC 1 cut(s) 424
Hin1II CATG 6 cut(s) 61, 415, 638, 741, 763, 835
Hin6I GCGC 1 cut(s) 422
HinP1I GCGC 1 cut(s) 422
HincII GTYRAC 3 cut(s) 517, 859, 973
HindII GTYRAC 3 cut(s) 517, 859, 973
HinfI GANTC 6 cut(s) 639, 706, 724, 742, 851, 1146
HpaI GTTAAC 1 cut(s) 517
HpaII CCGG 1 cut(s) 1281
HphI GGTGA 4 cut(s) 623, 847, 911, 1206
Hpy166II GTNNAC 5 cut(s) 458, 517, 859, 973, 1074
Hpy188I TCNGA 3 cut(s) 670, 964, 1093
Hpy188III TCNNGA 2 cut(s) 728, 1150
Hpy8I GTNNAC 5 cut(s) 458, 517, 859, 973, 1074
Hpy99I CGWCG 2 cut(s) 377, 397
HpyAV CCTTC 3 cut(s) 710, 714, 1097
HpyCH4III ACNGT 4 cut(s) 566, 770, 958, 1071
HpyCH4IV ACGT 1 cut(s) 375
HpyCH4V TGCA 7 cut(s) 350, 411, 417, 546, 947, 1224, 1271
HpyF10VI GCNNNNNNNGC 7 cut(s) 62, 123, 162, 201, 240, 428, 944
HpyF3I CTNAG 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 375
Hsp92II CATG 6 cut(s) 61, 415, 638, 741, 763, 835
HspAI GCGC 1 cut(s) 422
KspAI GTTAAC 1 cut(s) 517
Kzo9I GATC 2 cut(s) 578, 1093
LmnI GCTCC 3 cut(s) 403, 428, 788
Lsp1109I GCAGC 1 cut(s) 1276
LweI GCATC 2 cut(s) 814, 925
MaeI CTAG 2 cut(s) 389, 1112
MaeII ACGT 1 cut(s) 375
MaeIII GTNAC 7 cut(s) 308, 338, 356, 538, 728, 770, 952
MalI GATC 2 cut(s) 580, 1095
MboI GATC 2 cut(s) 578, 1093
MboII GAAGA 3 cut(s) 567, 1022, 1129
MflI RGATCY 1 cut(s) 578
MluCI AATT 4 cut(s) 351, 549, 1085, 1272
MlyI GAGTC 5 cut(s) 648, 700, 718, 860, 1155
MnlI CCTC 9 cut(s) 551, 606, 641, 789, 882, 895, 904, 1148, 1177
Mph1103I ATGCAT 1 cut(s) 413
MroXI GAANNNNTTC 1 cut(s) 1107
MseI TTAA 2 cut(s) 516, 1294
MslI CAYNNNNRTG 1 cut(s) 463
MspI CCGG 1 cut(s) 1281
MspR9I CCNGG 1 cut(s) 1131
Mva1269I GAATGC 1 cut(s) 470
MvaI CCWGG 1 cut(s) 1131
MwoI GCNNNNNNNGC 7 cut(s) 62, 123, 162, 201, 240, 428, 944
NcoI CCATGG 2 cut(s) 57, 634
NdeII GATC 2 cut(s) 578, 1093
NlaIII CATG 6 cut(s) 61, 415, 638, 741, 763, 835
NlaIV GGNNCC 2 cut(s) 430, 880
NmuCI GTSAC 4 cut(s) 356, 538, 728, 770
NsiI ATGCAT 1 cut(s) 413
NspI RCATGY 1 cut(s) 415
NspV TTCGAA 1 cut(s) 1082
PceI AGGCCT 1 cut(s) 994
PcsI WCGNNNNNNNCGW 1 cut(s) 927
PctI GAATGC 1 cut(s) 470
PdmI GAANNNNTTC 1 cut(s) 1107
PfeI GAWTC 1 cut(s) 742
PkrI GCNGC 1 cut(s) 1291
PleI GAGTC 5 cut(s) 647, 700, 718, 859, 1154
PpsI GAGTC 5 cut(s) 647, 700, 718, 859, 1154
Psp6I CCWGG 1 cut(s) 1129
PspGI CCWGG 1 cut(s) 1129
PspN4I GGNNCC 2 cut(s) 430, 880
PspPI GGNCC 1 cut(s) 879
PsuI RGATCY 1 cut(s) 578
RsaI GTAC 1 cut(s) 1193
RsaNI GTAC 1 cut(s) 1192
RseI CAYNNNNRTG 1 cut(s) 463
SalI GTCGAC 1 cut(s) 971
SaqAI TTAA 2 cut(s) 516, 1294
SatI GCNGC 1 cut(s) 1290
Sau3AI GATC 2 cut(s) 578, 1093
Sau96I GGNCC 1 cut(s) 879
SchI GAGTC 5 cut(s) 648, 700, 718, 860, 1155
ScrFI CCNGG 1 cut(s) 1131
SetI ASST 7 cut(s) 71, 378, 915, 1124, 1219, 1230, 1238
SfaNI GCATC 2 cut(s) 814, 925
SfcI CTRYAG 1 cut(s) 1123
SfuI TTCGAA 1 cut(s) 1082
SmiMI CAYNNNNRTG 1 cut(s) 463
Sse9I AATT 4 cut(s) 351, 549, 1085, 1272
SseBI AGGCCT 1 cut(s) 994
SsiI CCGC 1 cut(s) 522
SspMI CTAG 2 cut(s) 389, 1112
StuI AGGCCT 1 cut(s) 994
StyD4I CCNGG 1 cut(s) 1129
StyI CCWWGG 2 cut(s) 57, 634
TaaI ACNGT 4 cut(s) 566, 770, 958, 1071
TaiI ACGT 1 cut(s) 378
TaqI TCGA 7 cut(s) 598, 709, 765, 921, 972, 1082, 1144
TasI AATT 4 cut(s) 351, 549, 1085, 1272
TatI WGTACW 1 cut(s) 1191
TfiI GAWTC 1 cut(s) 742
Tru1I TTAA 2 cut(s) 516, 1294
Tru9I TTAA 2 cut(s) 516, 1294
TscAI CASTG 9 cut(s) 94, 127, 133, 166, 172, 205, 211, 244, 250
TseFI GTSAC 4 cut(s) 356, 538, 728, 770
TseI GCWGC 1 cut(s) 1289
Tsp45I GTSAC 4 cut(s) 356, 538, 728, 770
TspDTI ATGAA 3 cut(s) 687, 688, 1010
TspGWI ACGGA 5 cut(s) 111, 273, 297, 303, 327
TspRI CASTG 9 cut(s) 94, 127, 133, 166, 172, 205, 211, 244, 250
XceI RCATGY 1 cut(s) 415
XcmI CCANNNNNNNNNTGG 1 cut(s) 73
XmiI GTMKAC 1 cut(s) 972
XmnI GAANNNNTTC 1 cut(s) 1107
XspI CTAG 2 cut(s) 389, 1112
Zsp2I ATGCAT 1 cut(s) 413
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.