Rmu_sc0030540.1_g000001

acid phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030540.1
OG0012044
Physical Location & Seq
Forward (+)
1 .. 556
556 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030540.1_g000001.1.cds

Sequence Viewer

Length: 383 bp
tgacattcgatgaagaagcttttgatgagtgggtggatttggctgaggcccctgctatcgtagcaagtttgaatctgtacaaggggctccaacggttgggtttcaagattttcctgttgactgggcggagcgaatttcagagaaatgccacggtgaaaaacctcctatattcaggttacagtgactgggagaggctgctactgaggggaccttcagataaaggaacactcgcgactgaatacaaatccaagaagagggcagaactgatatccgaaggttatcgacttcatgggagctcgggagatcaatggagtgacttgtcgggctttgcagttgcccgacgatcctttaaacttccaaacccaatgtattatattgcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Acid_phosphat_B

Protein Analysis

126

Amino Acids

14.32

Weight (kDa)

7.84

Isoelectric Point (pI)

33.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012044)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G29260 AT4G29270
fragaria_vesca FvH4_1g06500
malus_domestica MD02G1068300.v1.1
prunus_persica Prupe.7G217300_v2.0.a1
pyrus_communis pycom02g05410 pycom08g17150 pycom15g17740
rosa_chinensis RchiOBHm_Chr2g0092251
rosa_laevigata RLG00000016290
rosa_multiflora Rmu_sc0000524.1_g000032 Rmu_sc0030540.1_g000001
rosa_roxburghii Rroxscaffold_2G00149330
rosa_rugosa Rorug02G0024100
rosa_samantha Rh2AG069900 Rh2BG069400 Rh2CG070600 Rh2DG068400
rosa_wichuraiana Rw2G006230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 96
AccII CGCG 1 cut(s) 232
AciI CCGC 1 cut(s) 126
AclWI GGATC 1 cut(s) 338
AcsI RAATTY 1 cut(s) 133
AcuI CTGAAG 1 cut(s) 197
AfaI GTAC 1 cut(s) 79
AfiI CCNNNNNNNGG 2 cut(s) 96, 254
AgsI TTSAA 2 cut(s) 72, 105
AluBI AGCT 2 cut(s) 19, 296
AluI AGCT 2 cut(s) 19, 296
Alw21I GWGCWC 1 cut(s) 298
AlwI GGATC 1 cut(s) 338
AlwNI CAGNNNCTG 1 cut(s) 185
Ama87I CYCGRG 1 cut(s) 297
AoxI GGCC 1 cut(s) 47
ApeKI GCWGC 1 cut(s) 195
ApoI RAATTY 1 cut(s) 133
AspS9I GGNCC 2 cut(s) 48, 208
AsuHPI GGTGA 1 cut(s) 165
AvaI CYCGRG 1 cut(s) 297
AvaII GGWCC 1 cut(s) 208
BanII GRGCYC 2 cut(s) 89, 298
Bbv12I GWGCWC 1 cut(s) 298
BbvCI CCTCAGC 1 cut(s) 44
BbvI GCAGC 1 cut(s) 182
BisI GCNGC 1 cut(s) 196
BlsI GCNGC 1 cut(s) 197
Bme18I GGWCC 1 cut(s) 208
BmeT110I CYCGRG 1 cut(s) 297
BmgT120I GGNCC 2 cut(s) 48, 208
BmiI GGNNCC 3 cut(s) 50, 88, 209
BmrI ACTGGG 2 cut(s) 131, 195
BmuI ACTGGG 2 cut(s) 131, 195
Bpu10I CCTNAGC 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 149
Bsc4I CCNNNNNNNGG 2 cut(s) 96, 254
Bse1I ACTGG 2 cut(s) 126, 190
BseDI CCNNGG 1 cut(s) 149
BseLI CCNNNNNNNGG 2 cut(s) 96, 254
BseMII CTCAG 2 cut(s) 35, 193
BseNI ACTGG 2 cut(s) 126, 190
BseXI GCAGC 1 cut(s) 182
Bsh1236I CGCG 1 cut(s) 232
BshFI GGCC 1 cut(s) 49
BsiHKAI GWGCWC 1 cut(s) 298
BsiHKCI CYCGRG 1 cut(s) 297
BslFI GGGAC 1 cut(s) 221
BslI CCNNNNNNNGG 2 cut(s) 96, 254
BsmFI GGGAC 1 cut(s) 221
BsnI GGCC 1 cut(s) 49
BsoBI CYCGRG 1 cut(s) 297
Bsp1286I GDGCHC 2 cut(s) 89, 298
Bsp1407I TGTACA 1 cut(s) 77
Bsp143I GATC 2 cut(s) 303, 343
Bsp68I TCGCGA 1 cut(s) 232
BspACI CCGC 1 cut(s) 126
BspANI GGCC 1 cut(s) 49
BspCNI CTCAG 2 cut(s) 36, 194
BspFNI CGCG 1 cut(s) 232
BspLI GGNNCC 3 cut(s) 50, 88, 209
BspPI GGATC 1 cut(s) 338
BsrGI TGTACA 1 cut(s) 77
BsrI ACTGG 2 cut(s) 126, 190
BssECI CCNNGG 1 cut(s) 149
BssMI GATC 2 cut(s) 303, 343
Bst4CI ACNGT 3 cut(s) 95, 153, 181
Bst6I CTCTTC 1 cut(s) 247
BstAUI TGTACA 1 cut(s) 77
BstDEI CTNAG 2 cut(s) 44, 202
BstDSI CCRYGG 1 cut(s) 149
BstFNI CGCG 1 cut(s) 232
BstKTI GATC 2 cut(s) 306, 346
BstMBI GATC 2 cut(s) 303, 343
BstMWI GCNNNNNNNGC 1 cut(s) 61
BstUI CGCG 1 cut(s) 232
BstV1I GCAGC 1 cut(s) 182
BsuRI GGCC 1 cut(s) 49
BtgI CCRYGG 1 cut(s) 149
BtsIMutI CAGTG 1 cut(s) 186
BtuMI TCGCGA 1 cut(s) 232
CaiI CAGNNNCTG 1 cut(s) 185
Cfr13I GGNCC 2 cut(s) 48, 208
Csp6I GTAC 1 cut(s) 78
CviAII CATG 1 cut(s) 289
CviJI RGCY 7 cut(s) 19, 43, 49, 87, 195, 296, 326
CviKI_1 RGCY 7 cut(s) 19, 43, 49, 87, 195, 296, 326
CviQI GTAC 1 cut(s) 78
DdeI CTNAG 2 cut(s) 44, 202
DpnI GATC 2 cut(s) 305, 345
DpnII GATC 2 cut(s) 303, 343
DraI TTTAAA 1 cut(s) 351
Eam1104I CTCTTC 1 cut(s) 247
EarI CTCTTC 1 cut(s) 247
EciI GGCGGA 1 cut(s) 141
Ecl136II GAGCTC 1 cut(s) 296
Eco24I GRGCYC 2 cut(s) 89, 298
Eco32I GATATC 1 cut(s) 269
Eco47I GGWCC 1 cut(s) 208
Eco53kI GAGCTC 1 cut(s) 296
Eco57I CTGAAG 1 cut(s) 197
Eco88I CYCGRG 1 cut(s) 297
EcoICRI GAGCTC 1 cut(s) 296
EcoO109I RGGNCCY 2 cut(s) 48, 208
EcoRV GATATC 1 cut(s) 269
EcoT38I GRGCYC 2 cut(s) 89, 298
FaeI CATG 1 cut(s) 292
FaiI YATR 4 cut(s) 168, 290, 374, 381
FaqI GGGAC 1 cut(s) 221
FatI CATG 1 cut(s) 288
Fnu4HI GCNGC 1 cut(s) 196
FriOI GRGCYC 2 cut(s) 89, 298
Fsp4HI GCNGC 1 cut(s) 196
GluI GCNGC 1 cut(s) 196
HaeIII GGCC 1 cut(s) 49
Hin1II CATG 1 cut(s) 292
HincII GTYRAC 1 cut(s) 119
HindII GTYRAC 1 cut(s) 119
HindIII AAGCTT 1 cut(s) 17
HinfI GANTC 1 cut(s) 72
HphI GGTGA 1 cut(s) 165
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 3 cut(s) 140, 216, 273
Hpy188III TCNNGA 3 cut(s) 105, 231, 299
Hpy8I GTNNAC 1 cut(s) 119
Hpy99I CGWCG 1 cut(s) 344
HpyAV CCTTC 2 cut(s) 221, 268
HpyCH4III ACNGT 3 cut(s) 95, 153, 181
HpyCH4V TGCA 2 cut(s) 331, 379
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
HpyF3I CTNAG 2 cut(s) 44, 202
Hsp92II CATG 1 cut(s) 292
Kzo9I GATC 2 cut(s) 303, 343
LmnI GCTCC 3 cut(s) 92, 128, 293
LpnPI CCDG 5 cut(s) 65, 107, 127, 158, 171
Lsp1109I GCAGC 1 cut(s) 182
MaeIII GTNAC 3 cut(s) 175, 181, 313
MalI GATC 2 cut(s) 305, 345
MboI GATC 2 cut(s) 303, 343
MboII GAAGA 2 cut(s) 25, 264
MhlI GDGCHC 2 cut(s) 89, 298
MluCI AATT 1 cut(s) 133
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 5 cut(s) 39, 172, 185, 197, 248
MseI TTAA 1 cut(s) 350
MvnI CGCG 1 cut(s) 232
MwoI GCNNNNNNNGC 1 cut(s) 61
NdeII GATC 2 cut(s) 303, 343
NlaIII CATG 1 cut(s) 292
NlaIV GGNNCC 3 cut(s) 50, 88, 209
NmuCI GTSAC 2 cut(s) 181, 313
NruI TCGCGA 1 cut(s) 232
PfeI GAWTC 1 cut(s) 72
PflMI CCANNNNNTGG 1 cut(s) 96
PkrI GCNGC 1 cut(s) 197
PpuMI RGGWCCY 1 cut(s) 208
Psp124BI GAGCTC 1 cut(s) 298
Psp5II RGGWCCY 1 cut(s) 208
PspN4I GGNNCC 3 cut(s) 50, 88, 209
PspPI GGNCC 2 cut(s) 48, 208
PspPPI RGGWCCY 1 cut(s) 208
PstNI CAGNNNCTG 1 cut(s) 185
RruI TCGCGA 1 cut(s) 232
RsaI GTAC 1 cut(s) 79
RsaNI GTAC 1 cut(s) 78
SacI GAGCTC 1 cut(s) 298
SaqAI TTAA 1 cut(s) 350
SatI GCNGC 1 cut(s) 196
Sau3AI GATC 2 cut(s) 303, 343
Sau96I GGNCC 2 cut(s) 48, 208
SduI GDGCHC 2 cut(s) 89, 298
SetI ASST 6 cut(s) 21, 164, 177, 213, 279, 298
SinI GGWCC 1 cut(s) 208
Sse9I AATT 1 cut(s) 133
SsiI CCGC 1 cut(s) 126
SstI GAGCTC 1 cut(s) 298
TaaI ACNGT 3 cut(s) 95, 153, 181
TaqI TCGA 2 cut(s) 8, 282
TasI AATT 1 cut(s) 133
TatI WGTACW 1 cut(s) 77
TfiI GAWTC 1 cut(s) 72
Tru1I TTAA 1 cut(s) 350
Tru9I TTAA 1 cut(s) 350
TscAI CASTG 1 cut(s) 186
TseFI GTSAC 2 cut(s) 181, 313
TseI GCWGC 1 cut(s) 195
Tsp45I GTSAC 2 cut(s) 181, 313
TspDTI ATGAA 2 cut(s) 26, 277
TspRI CASTG 1 cut(s) 186
Van91I CCANNNNNTGG 1 cut(s) 96
VpaK11BI GGWCC 1 cut(s) 208
XapI RAATTY 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.