Rmu_sc0035747.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0035747.1
Physical Location & Seq
Reverse (-)
933 .. 1361
429 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0035747.1_g000002.1.cds

Sequence Viewer

Length: 345 bp
ctgcaaacctccactgtgtcagacctaaatggtggagacagcagtatcatagaattaacgacagaatctgagtcttctgcagattcgtcttcctcaaagcagttaattgctaagagtaaagaagagaaggttcctcgcaaaaagcaagctgtgaaagggaaagaagaagggactcctaagaagaagttaaccgtgaaagaaaaagcaccaaaagcaccaaaagttccaaagttggtcgtcctcgggtcttccaagaggttaagggtcaaggagaaggctgtgcttagtgatgtgttctcgaaatatgggttaaacccagctttggcttcaaatgaagatagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.2

Weight (kDa)

9.7

Isoelectric Point (pI)

54.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012534)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 322
AgsI TTSAA 1 cut(s) 330
AluBI AGCT 2 cut(s) 149, 320
AluI AGCT 2 cut(s) 149, 320
Alw26I GTCTC 1 cut(s) 30
AlwNI CAGNNNCTG 1 cut(s) 68
Ama87I CYCGRG 1 cut(s) 242
AvaI CYCGRG 1 cut(s) 242
BaeI ACNNNNGTAYC 2 cut(s) 28, 61
BbsI GAAGAC 3 cut(s) 66, 81, 240
BcoDI GTCTC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 78
BmeT110I CYCGRG 1 cut(s) 242
BmiI GGNNCC 1 cut(s) 132
BpiI GAAGAC 3 cut(s) 66, 81, 240
BsaJI CCNNGG 1 cut(s) 241
Bsc4I CCNNNNNNNGG 1 cut(s) 322
BseDI CCNNGG 1 cut(s) 241
BseLI CCNNNNNNNGG 1 cut(s) 322
BseMII CTCAG 1 cut(s) 60
BseYI CCCAGC 1 cut(s) 316
BsiHKCI CYCGRG 1 cut(s) 242
BslFI GGGAC 1 cut(s) 184
BslI CCNNNNNNNGG 1 cut(s) 322
BsmAI GTCTC 1 cut(s) 30
BsmFI GGGAC 1 cut(s) 184
BsoBI CYCGRG 1 cut(s) 242
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 132
BspMAI CTGCAG 1 cut(s) 82
BssECI CCNNGG 1 cut(s) 241
Bst4CI ACNGT 2 cut(s) 16, 193
Bst6I CTCTTC 1 cut(s) 117
BstC8I GCNNGC 1 cut(s) 147
BstDEI CTNAG 4 cut(s) 69, 111, 177, 284
BstMAI GTCTC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstSFI CTRYAG 1 cut(s) 78
BstV2I GAAGAC 3 cut(s) 66, 81, 240
BtsIMutI CAGTG 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 147
CaiI CAGNNNCTG 1 cut(s) 68
CviJI RGCY 4 cut(s) 149, 278, 320, 326
CviKI_1 RGCY 4 cut(s) 149, 278, 320, 326
DdeI CTNAG 4 cut(s) 69, 111, 177, 284
Eam1104I CTCTTC 1 cut(s) 117
EarI CTCTTC 1 cut(s) 117
Eco88I CYCGRG 1 cut(s) 242
FaiI YATR 2 cut(s) 50, 306
FaqI GGGAC 1 cut(s) 184
GsaI CCCAGC 1 cut(s) 320
HincII GTYRAC 1 cut(s) 189
HindII GTYRAC 1 cut(s) 189
HinfI GANTC 4 cut(s) 65, 71, 83, 172
HpaI GTTAAC 1 cut(s) 189
Hpy166II GTNNAC 1 cut(s) 189
Hpy188I TCNGA 2 cut(s) 22, 70
Hpy188III TCNNGA 1 cut(s) 298
Hpy8I GTNNAC 1 cut(s) 189
HpyAV CCTTC 3 cut(s) 121, 161, 268
HpyCH4III ACNGT 2 cut(s) 16, 193
HpyCH4V TGCA 2 cut(s) 4, 80
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 4 cut(s) 69, 111, 177, 284
KspAI GTTAAC 1 cut(s) 189
LpnPI CCDG 1 cut(s) 330
MboII GAAGA 6 cut(s) 66, 81, 134, 176, 193, 240
MluCI AATT 2 cut(s) 53, 105
MlyI GAGTC 2 cut(s) 80, 166
MnlI CCTC 5 cut(s) 19, 103, 144, 249, 251
MseI TTAA 5 cut(s) 56, 104, 188, 260, 311
MwoI GCNNNNNNNGC 1 cut(s) 212
NlaIV GGNNCC 1 cut(s) 132
PfeI GAWTC 2 cut(s) 65, 83
PleI GAGTC 2 cut(s) 79, 166
PpsI GAGTC 2 cut(s) 79, 166
PspFI CCCAGC 1 cut(s) 316
PspN4I GGNNCC 1 cut(s) 132
PstI CTGCAG 1 cut(s) 82
PstNI CAGNNNCTG 1 cut(s) 68
SaqAI TTAA 5 cut(s) 56, 104, 188, 260, 311
SchI GAGTC 2 cut(s) 80, 166
SetI ASST 6 cut(s) 11, 27, 132, 151, 260, 322
SfcI CTRYAG 1 cut(s) 78
SgeI CNNG 9 cut(s) 147, 158, 205, 254, 256, 265, 280, 310, 329
Sse9I AATT 2 cut(s) 53, 105
TaaI ACNGT 2 cut(s) 16, 193
TaqI TCGA 1 cut(s) 299
TasI AATT 2 cut(s) 53, 105
TfiI GAWTC 2 cut(s) 65, 83
Tru1I TTAA 5 cut(s) 56, 104, 188, 260, 311
Tru9I TTAA 5 cut(s) 56, 104, 188, 260, 311
TscAI CASTG 1 cut(s) 19
TspRI CASTG 1 cut(s) 19
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.