Rmu_sc0037809.1_g000001

Phytochromobilin ferredoxin oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037809.1
Physical Location & Seq
Forward (+)
1 .. 1625
1625 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037809.1_g000001.1.cds

Sequence Viewer

Length: 439 bp
ggacctcaaccctttgcacaacgttattattgaaagagaatacagagataaatactacaaaggcctaatacctcttggtgtcaaatatgctgagcttttaccatggggtgggaagcttactagcgagtcattgaaatttttttcacccattgttatatggacaagatttacgtcaagtccagaaaaatatgaggttttatattcggctttcatggattattacaaggcatggctcgagctgatggaccaagcagtagtggagacaaatgcctctcaaattaaacgtaaccgtgaagcgcaacatcgatatctaacttggagagcagaaaaggatcttaaaatagatcttctctctgcaaaacagtgctattgtggaattcctaaagggatggtctaccttttatggaagttcattatctttaagctgtaccaaaagtga

Protein Analysis

145

Amino Acids

17.32

Weight (kDa)

9.21

Isoelectric Point (pI)

23.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 108
AccI GTMKAC 1 cut(s) 394
AclI AACGTT 1 cut(s) 22
AclWI GGATC 1 cut(s) 340
AcsI RAATTY 2 cut(s) 135, 376
AfaI GTAC 1 cut(s) 429
AfiI CCNNNNNNNGG 1 cut(s) 108
AgsI TTSAA 2 cut(s) 33, 134
AluBI AGCT 4 cut(s) 95, 116, 239, 425
AluI AGCT 4 cut(s) 95, 116, 239, 425
Alw26I GTCTC 1 cut(s) 255
AlwI GGATC 1 cut(s) 340
Ama87I CYCGRG 1 cut(s) 234
AoxI GGCC 1 cut(s) 62
ApoI RAATTY 2 cut(s) 135, 376
AspLEI GCGC 1 cut(s) 299
AspS9I GGNCC 2 cut(s) 2, 245
AsuHPI GGTGA 1 cut(s) 136
AvaI CYCGRG 1 cut(s) 234
AvaII GGWCC 2 cut(s) 2, 245
BccI CCATC 2 cut(s) 236, 383
BcoDI GTCTC 1 cut(s) 255
BfaI CTAG 1 cut(s) 121
BglII AGATCT 1 cut(s) 344
BlpI GCTNAGC 1 cut(s) 91
Bme18I GGWCC 2 cut(s) 2, 245
BmeT110I CYCGRG 1 cut(s) 234
BmgT120I GGNCC 2 cut(s) 2, 245
Bpu1102I GCTNAGC 1 cut(s) 91
Bsa29I ATCGAT 1 cut(s) 305
BsaJI CCNNGG 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 108
BseCI ATCGAT 1 cut(s) 305
BseDI CCNNGG 1 cut(s) 102
BseGI GGATG 1 cut(s) 394
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 82
BshFI GGCC 1 cut(s) 64
BshVI ATCGAT 1 cut(s) 305
BsiHKCI CYCGRG 1 cut(s) 234
BslI CCNNNNNNNGG 1 cut(s) 108
BsmAI GTCTC 1 cut(s) 255
BsnI GGCC 1 cut(s) 64
BsoBI CYCGRG 1 cut(s) 234
Bsp143I GATC 2 cut(s) 332, 344
Bsp1720I GCTNAGC 1 cut(s) 91
Bsp19I CCATGG 1 cut(s) 102
BspANI GGCC 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 83
BspDI ATCGAT 1 cut(s) 305
BspPI GGATC 1 cut(s) 340
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 2 cut(s) 332, 344
BssT1I CCWWGG 1 cut(s) 102
Bst4CI ACNGT 2 cut(s) 291, 364
BstDEI CTNAG 1 cut(s) 91
BstDSI CCRYGG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 394
BstHHI GCGC 1 cut(s) 299
BstKTI GATC 2 cut(s) 335, 347
BstMAI GTCTC 1 cut(s) 255
BstMBI GATC 2 cut(s) 332, 344
BstX2I RGATCY 2 cut(s) 332, 344
BstYI RGATCY 2 cut(s) 332, 344
Bsu15I ATCGAT 1 cut(s) 305
BsuRI GGCC 1 cut(s) 64
BsuTUI ATCGAT 1 cut(s) 305
BtgI CCRYGG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 394
BtsIMutI CAGTG 1 cut(s) 369
CfoI GCGC 1 cut(s) 299
Cfr13I GGNCC 2 cut(s) 2, 245
ClaI ATCGAT 1 cut(s) 305
Csp6I GTAC 1 cut(s) 428
CviAII CATG 3 cut(s) 103, 212, 229
CviJI RGCY 7 cut(s) 64, 95, 116, 207, 233, 239, 425
CviKI_1 RGCY 7 cut(s) 64, 95, 116, 207, 233, 239, 425
CviQI GTAC 1 cut(s) 428
DdeI CTNAG 1 cut(s) 91
DpnI GATC 2 cut(s) 334, 346
DpnII GATC 2 cut(s) 332, 344
Eco130I CCWWGG 1 cut(s) 102
Eco147I AGGCCT 1 cut(s) 64
Eco32I GATATC 1 cut(s) 309
Eco47I GGWCC 2 cut(s) 2, 245
Eco88I CYCGRG 1 cut(s) 234
EcoRI GAATTC 1 cut(s) 376
EcoRV GATATC 1 cut(s) 309
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaeI CATG 3 cut(s) 106, 215, 232
FaiI YATR 9 cut(s) 88, 104, 156, 158, 190, 200, 213, 230, 404
FatI CATG 3 cut(s) 102, 211, 228
FblI GTMKAC 1 cut(s) 394
FokI GGATG 1 cut(s) 401
FspBI CTAG 1 cut(s) 121
GlaI GCGC 1 cut(s) 298
HaeIII GGCC 1 cut(s) 64
HhaI GCGC 1 cut(s) 299
Hin1II CATG 3 cut(s) 106, 215, 232
Hin6I GCGC 1 cut(s) 297
HinP1I GCGC 1 cut(s) 297
HindIII AAGCTT 1 cut(s) 114
HinfI GANTC 1 cut(s) 126
HphI GGTGA 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 395
Hpy188III TCNNGA 1 cut(s) 180
Hpy8I GTNNAC 1 cut(s) 395
HpyCH4III ACNGT 2 cut(s) 291, 364
HpyCH4IV ACGT 3 cut(s) 22, 171, 284
HpyCH4V TGCA 2 cut(s) 17, 357
HpyF3I CTNAG 1 cut(s) 91
HpySE526I ACGT 3 cut(s) 22, 171, 284
Hsp92II CATG 3 cut(s) 106, 215, 232
HspAI GCGC 1 cut(s) 297
Kzo9I GATC 2 cut(s) 332, 344
LpnPI CCDG 1 cut(s) 193
MaeI CTAG 1 cut(s) 121
MaeII ACGT 3 cut(s) 22, 171, 284
MaeIII GTNAC 1 cut(s) 285
MalI GATC 2 cut(s) 334, 346
MboI GATC 2 cut(s) 332, 344
MboII GAAGA 1 cut(s) 339
MflI RGATCY 2 cut(s) 332, 344
MluCI AATT 3 cut(s) 135, 277, 376
MlyI GAGTC 1 cut(s) 135
MnlI CCTC 4 cut(s) 15, 82, 185, 281
MseI TTAA 3 cut(s) 280, 337, 421
NcoI CCATGG 1 cut(s) 102
NdeII GATC 2 cut(s) 332, 344
NlaIII CATG 3 cut(s) 106, 215, 232
PaeR7I CTCGAG 1 cut(s) 234
PceI AGGCCT 1 cut(s) 64
PflMI CCANNNNNTGG 1 cut(s) 108
PleI GAGTC 1 cut(s) 134
PpsI GAGTC 1 cut(s) 134
Psp1406I AACGTT 1 cut(s) 22
PspPI GGNCC 2 cut(s) 2, 245
PspXI VCTCGAGB 1 cut(s) 234
PsuI RGATCY 2 cut(s) 332, 344
RsaI GTAC 1 cut(s) 429
RsaNI GTAC 1 cut(s) 428
SaqAI TTAA 3 cut(s) 280, 337, 421
Sau3AI GATC 2 cut(s) 332, 344
Sau96I GGNCC 2 cut(s) 2, 245
SchI GAGTC 1 cut(s) 135
Sfr274I CTCGAG 1 cut(s) 234
SinI GGWCC 2 cut(s) 2, 245
SlaI CTCGAG 1 cut(s) 234
SmlI CTYRAG 1 cut(s) 234
SmoI CTYRAG 1 cut(s) 234
Sse9I AATT 3 cut(s) 135, 277, 376
SseBI AGGCCT 1 cut(s) 64
SspMI CTAG 1 cut(s) 121
StuI AGGCCT 1 cut(s) 64
StyI CCWWGG 1 cut(s) 102
TaaI ACNGT 2 cut(s) 291, 364
TaiI ACGT 3 cut(s) 25, 174, 287
TaqI TCGA 2 cut(s) 235, 305
TasI AATT 3 cut(s) 135, 277, 376
Tru1I TTAA 3 cut(s) 280, 337, 421
Tru9I TTAA 3 cut(s) 280, 337, 421
TscAI CASTG 1 cut(s) 369
TspDTI ATGAA 2 cut(s) 200, 401
TspRI CASTG 1 cut(s) 369
Van91I CCANNNNNTGG 1 cut(s) 108
VpaK11BI GGWCC 2 cut(s) 2, 245
XapI RAATTY 2 cut(s) 135, 376
XhoI CTCGAG 1 cut(s) 234
XmiI GTMKAC 1 cut(s) 394
XspI CTAG 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.