Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0039594.1

Orthogroup ID

OG0012878

Physical Location & Seq

Genomic Coordinates Forward (+)

611 .. 1497

Gene Structure 887 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0039594.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 219 bp

atgatgctggatcctgttcgcatttatgcgacagccatatacattgcgagcataataattgcattgttttgtgctctctatgctcataacaaaatattgacacttttggcaataattttggaatttggtgcattggtttggtatagcttgagctacattccttttgcaaggtccatggtatcgaagatcatgctagcttgttttgacactgaattttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0006810 GO:0008150 GO:0016020 GO:0016192 GO:0051179 GO:0051234

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Got1

Protein Analysis

72

Amino Acids

8.17

Weight (kDa)

6.51

Isoelectric Point (pI)

42.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012878)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G23550
fragaria_vesca	FvH4_1g25890
malus_domestica	MD15G1140900.v1.1
prunus_persica	Prupe.4G288900_v2.0.a1 Prupe.4G288900_v2.0.a1
pyrus_communis	pycom15g12730
rosa_chinensis	RchiOBHm_Chr3g0485031
rosa_laevigata	RLG00000023174
rosa_multiflora	Rmu_sc0006040.1_g000017 Rmu_sc0008046.1_g000005 Rmu_sc0039594.1_g000001
rosa_roxburghii	Rroxscaffold_6G00397240
rosa_rugosa	Rorug03G0215200 Rorug03G0215300
rosa_samantha	Rh3AG265700 Rh3BG301300 Rh3CG299600 Rh3DG295400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	5, 18
AcsI	RAATTY	2 cut(s)	122, 212
AluBI	AGCT	3 cut(s)	147, 153, 197
AluI	AGCT	3 cut(s)	147, 153, 197
Alw21I	GWGCWC	1 cut(s)	76
AlwI	GGATC	2 cut(s)	5, 18
ApoI	RAATTY	2 cut(s)	122, 212
AspS9I	GGNCC	1 cut(s)	171
AsuNHI	GCTAGC	1 cut(s)	193
AvaII	GGWCC	1 cut(s)	171
BamHI	GGATCC	1 cut(s)	10
Bbv12I	GWGCWC	1 cut(s)	76
BcgI	CGANNNNNNTGC	2 cut(s)	172, 206
BfaI	CTAG	1 cut(s)	194
Bme18I	GGWCC	1 cut(s)	171
BmgT120I	GGNCC	1 cut(s)	171
BmiI	GGNNCC	1 cut(s)	12
BmtI	GCTAGC	1 cut(s)	197
BpuEI	CTTGAG	1 cut(s)	169
BsaJI	CCNNGG	1 cut(s)	174
Bse3DI	GCAATG	1 cut(s)	42
BseDI	CCNNGG	1 cut(s)	174
BseMI	GCAATG	1 cut(s)	42
BsiHKAI	GWGCWC	1 cut(s)	76
Bsp1286I	GDGCHC	1 cut(s)	76
Bsp143I	GATC	2 cut(s)	10, 186
Bsp19I	CCATGG	1 cut(s)	174
BspLI	GGNNCC	1 cut(s)	12
BspOI	GCTAGC	1 cut(s)	197
BspPI	GGATC	2 cut(s)	5, 18
BsrDI	GCAATG	1 cut(s)	42
BssECI	CCNNGG	1 cut(s)	174
BssMI	GATC	2 cut(s)	10, 186
BssT1I	CCWWGG	1 cut(s)	174
BstC8I	GCNNGC	2 cut(s)	49, 195
BstDSI	CCRYGG	1 cut(s)	174
BstKTI	GATC	2 cut(s)	13, 189
BstMBI	GATC	2 cut(s)	10, 186
BstMWI	GCNNNNNNNGC	1 cut(s)	80
BstX2I	RGATCY	1 cut(s)	10
BstYI	RGATCY	1 cut(s)	10
BtgI	CCRYGG	1 cut(s)	174
BtsIMutI	CAGTG	1 cut(s)	207
Cac8I	GCNNGC	2 cut(s)	49, 195
Cfr13I	GGNCC	1 cut(s)	171
CviAII	CATG	2 cut(s)	175, 190
CviJI	RGCY	4 cut(s)	35, 147, 153, 197
CviKI_1	RGCY	4 cut(s)	35, 147, 153, 197
DpnI	GATC	2 cut(s)	12, 188
DpnII	GATC	2 cut(s)	10, 186
Eco130I	CCWWGG	1 cut(s)	174
Eco47I	GGWCC	1 cut(s)	171
EcoT14I	CCWWGG	1 cut(s)	174
ErhI	CCWWGG	1 cut(s)	174
FaeI	CATG	2 cut(s)	178, 193
FaiI	YATR	9 cut(s)	27, 38, 40, 53, 81, 87, 144, 176, 191
FatI	CATG	2 cut(s)	174, 189
FspBI	CTAG	1 cut(s)	194
Hin1II	CATG	2 cut(s)	178, 193
HpyCH4V	TGCA	3 cut(s)	62, 131, 167
HpyF10VI	GCNNNNNNNGC	1 cut(s)	80
Hsp92II	CATG	2 cut(s)	178, 193
Kzo9I	GATC	2 cut(s)	10, 186
LpnPI	CCDG	1 cut(s)	27
MaeI	CTAG	1 cut(s)	194
MalI	GATC	2 cut(s)	12, 188
MboI	GATC	2 cut(s)	10, 186
MboII	GAAGA	1 cut(s)	196
MflI	RGATCY	1 cut(s)	10
MhlI	GDGCHC	1 cut(s)	76
MluCI	AATT	4 cut(s)	57, 114, 122, 212
MwoI	GCNNNNNNNGC	1 cut(s)	80
NcoI	CCATGG	1 cut(s)	174
NdeII	GATC	2 cut(s)	10, 186
NheI	GCTAGC	1 cut(s)	193
NlaIII	CATG	2 cut(s)	178, 193
NlaIV	GGNNCC	1 cut(s)	12
PspN4I	GGNNCC	1 cut(s)	12
PspPI	GGNCC	1 cut(s)	171
PsuI	RGATCY	1 cut(s)	10
Sau3AI	GATC	2 cut(s)	10, 186
Sau96I	GGNCC	1 cut(s)	171
SduI	GDGCHC	1 cut(s)	76
SetI	ASST	4 cut(s)	149, 155, 173, 199
SgeI	CNNG	9 cut(s)	20, 26, 60, 160, 180, 187, 202, 206, 210
SinI	GGWCC	1 cut(s)	171
SmlI	CTYRAG	1 cut(s)	148
SmoI	CTYRAG	1 cut(s)	148
Sse9I	AATT	4 cut(s)	57, 114, 122, 212
SspI	AATATT	1 cut(s)	96
SspMI	CTAG	1 cut(s)	194
StyI	CCWWGG	1 cut(s)	174
TaqI	TCGA	1 cut(s)	182
TasI	AATT	4 cut(s)	57, 114, 122, 212
TscAI	CASTG	1 cut(s)	214
TspRI	CASTG	1 cut(s)	214
VpaK11BI	GGWCC	1 cut(s)	171
XapI	RAATTY	2 cut(s)	122, 212
XspI	CTAG	1 cut(s)	194

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.