Rmu_sc0042180.1_g000001

THUMP domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0042180.1
Physical Location & Seq
Reverse (-)
1 .. 978
978 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0042180.1_g000001.1.cds

Sequence Viewer

Length: 210 bp
atgcggaagagagatggagatcctggccccaaagatattgtacagcatatgatgacatctgctgctgcaacaaggaaacacatgtcgaggtttatcttaagggtattgcctgtcgaagtatcatgctatgcttcggaagaggagatttccagagcaattaaacctcttcttgcacaatattttcccttggaaactcagagtcctcggaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.01

Weight (kDa)

9.65

Isoelectric Point (pI)

66.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012337)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 4
AclWI GGATC 1 cut(s) 14
AfaI GTAC 1 cut(s) 42
AflII CTTAAG 1 cut(s) 97
AflIII ACRYGT 1 cut(s) 81
AjnI CCWGG 1 cut(s) 22
AlwI GGATC 1 cut(s) 14
AoxI GGCC 1 cut(s) 25
ApeKI GCWGC 2 cut(s) 62, 65
AspS9I GGNCC 1 cut(s) 26
BbvI GCAGC 2 cut(s) 49, 52
BccI CCATC 1 cut(s) 8
BciT130I CCWGG 1 cut(s) 24
BfrI CTTAAG 1 cut(s) 97
BisI GCNGC 2 cut(s) 63, 66
BlsI GCNGC 2 cut(s) 64, 67
Bme1390I CCNGG 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 26
BmiI GGNNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 24
BsaBI GATNNNNATC 1 cut(s) 18
BsaJI CCNNGG 2 cut(s) 186, 203
Bse8I GATNNNNATC 1 cut(s) 18
BseBI CCWGG 1 cut(s) 24
BseDI CCNNGG 2 cut(s) 186, 203
BseJI GATNNNNATC 1 cut(s) 18
BseMII CTCAG 1 cut(s) 209
BseRI GAGGAG 1 cut(s) 155
BseXI GCAGC 2 cut(s) 49, 52
BshFI GGCC 1 cut(s) 27
BsnI GGCC 1 cut(s) 27
Bsp1407I TGTACA 1 cut(s) 40
Bsp143I GATC 1 cut(s) 19
BspACI CCGC 1 cut(s) 4
BspANI GGCC 1 cut(s) 27
BspCNI CTCAG 1 cut(s) 208
BspLI GGNNCC 1 cut(s) 28
BspPI GGATC 1 cut(s) 14
BspTI CTTAAG 1 cut(s) 97
BsrGI TGTACA 1 cut(s) 40
BssECI CCNNGG 2 cut(s) 186, 203
BssMI GATC 1 cut(s) 19
BssT1I CCWWGG 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 24
Bst6I CTCTTC 3 cut(s) 2, 132, 171
BstAFI CTTAAG 1 cut(s) 97
BstAUI TGTACA 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 195
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstNI CCWGG 1 cut(s) 24
BstNSI RCATGY 1 cut(s) 85
BstSCI CCNGG 1 cut(s) 22
BstV1I GCAGC 2 cut(s) 49, 52
BstX2I RGATCY 1 cut(s) 19
BstYI RGATCY 1 cut(s) 19
BsuRI GGCC 1 cut(s) 27
Cfr13I GGNCC 1 cut(s) 26
Csp6I GTAC 1 cut(s) 41
CviAII CATG 2 cut(s) 82, 123
CviJI RGCY 1 cut(s) 27
CviKI_1 RGCY 1 cut(s) 27
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eam1104I CTCTTC 3 cut(s) 2, 132, 171
EarI CTCTTC 3 cut(s) 2, 132, 171
Eco130I CCWWGG 1 cut(s) 186
EcoRII CCWGG 1 cut(s) 22
EcoT14I CCWWGG 1 cut(s) 186
ErhI CCWWGG 1 cut(s) 186
FaeI CATG 2 cut(s) 85, 126
FaiI YATR 5 cut(s) 48, 50, 83, 124, 129
FatI CATG 2 cut(s) 81, 122
FauNDI CATATG 1 cut(s) 48
Fnu4HI GCNGC 2 cut(s) 63, 66
Fsp4HI GCNGC 2 cut(s) 63, 66
GluI GCNGC 2 cut(s) 63, 66
HaeIII GGCC 1 cut(s) 27
Hin1II CATG 2 cut(s) 85, 126
HinfI GANTC 1 cut(s) 199
Hpy188I TCNGA 3 cut(s) 136, 198, 207
Hpy188III TCNNGA 1 cut(s) 150
HpyCH4V TGCA 2 cut(s) 68, 173
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 2 cut(s) 85, 126
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 4 cut(s) 9, 36, 123, 163
Lsp1109I GCAGC 2 cut(s) 49, 52
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 3 cut(s) 19, 149, 158
MflI RGATCY 1 cut(s) 19
MluCI AATT 1 cut(s) 156
MlyI GAGTC 1 cut(s) 208
MnlI CCTC 3 cut(s) 81, 133, 174
MseI TTAA 2 cut(s) 98, 159
MspCI CTTAAG 1 cut(s) 97
MspR9I CCNGG 1 cut(s) 24
MvaI CCWGG 1 cut(s) 24
NdeI CATATG 1 cut(s) 48
NdeII GATC 1 cut(s) 19
NlaIII CATG 2 cut(s) 85, 126
NlaIV GGNNCC 1 cut(s) 28
NspI RCATGY 1 cut(s) 85
PciI ACATGT 1 cut(s) 81
PkrI GCNGC 2 cut(s) 64, 67
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
PscI ACATGT 1 cut(s) 81
Psp6I CCWGG 1 cut(s) 22
PspGI CCWGG 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 28
PspPI GGNCC 1 cut(s) 26
PsuI RGATCY 1 cut(s) 19
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
SaqAI TTAA 2 cut(s) 98, 159
SatI GCNGC 2 cut(s) 63, 66
Sau3AI GATC 1 cut(s) 19
Sau96I GGNCC 1 cut(s) 26
SchI GAGTC 1 cut(s) 208
ScrFI CCNGG 1 cut(s) 24
SetI ASST 2 cut(s) 92, 166
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
Sse9I AATT 1 cut(s) 156
SsiI CCGC 1 cut(s) 4
SspI AATATT 1 cut(s) 179
StyD4I CCNGG 1 cut(s) 22
StyI CCWWGG 1 cut(s) 186
TaqI TCGA 2 cut(s) 86, 114
TasI AATT 1 cut(s) 156
TatI WGTACW 1 cut(s) 40
Tru1I TTAA 2 cut(s) 98, 159
Tru9I TTAA 2 cut(s) 98, 159
TseI GCWGC 2 cut(s) 62, 65
Vha464I CTTAAG 1 cut(s) 97
XceI RCATGY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.