Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000107.1

Orthogroup ID

OG0015203

Physical Location & Seq

Genomic Coordinates Reverse (-)

781 .. 1611

Gene Structure 831 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000107.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 831 bp

atggttttaaattgtgctaggttggtgaacaaagtcgcagttataactgggggtgcaagagggattggagctgctgcggccaagctatttgcccgaaacggcgcccatgttgtgattgccgacatacttgacgatttgggagctgcactggctgactctattgggggacagtacatacactgtgatgtgtccaaggaatctgatgttgaatcagctattgagcttgcactcggaaggacaggccagcttgacatcatgttcaacaatgctggtatttctggcccgtccgggagtataaccagccttgacatgggaaaggtgcagcaactgctctcagtaaacactttcggctgtttacatgggattaagtatgcagcagcagctatgctcaaaaccagaacaggcgggagcatcatctgcacatcaagcactgcagctatcatgggaggccttggtgggcatgcctacacattgtcaaaggaatccatcaatggactggtgagaagtgccgcatgtgagttgggagtccatggcattcgagtgaacagtatttctccacacggggttccttcagagatgctggtcgctgcctacagagagattcttgggaaagaggatatgcaggccgaagatgtaagcaagattgtggcagacagggcgagcttgttgcgtggcagatgtggaaccatggaagatgtcgcagaagctgcattattccttgccagtgaagactcagggttcataacagcccataatcttgtccttgatgggggttatacttctgctgtcagtaccatgagcttcatttatcaatttaccaatagacaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

adh_short_C2

Protein Analysis

276

Amino Acids

28.58

Weight (kDa)

5.78

Isoelectric Point (pI)

27.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015203)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G42960
fragaria_vesca	FvH4_4g35960
malus_domestica	MD13G1013400.v1.1 MD16G1010300.v1.1
prunus_persica	Prupe.1G340300_v2.0.a1
pyrus_communis	pycom16g01010
rosa_laevigata	RLG00000005727
rosa_multiflora	Rmu_ssc0000107.1_g000001 Rmu_ssc0000253.1_g000009
rosa_roxburghii	Rroxscaffold_5G00386070
rosa_rugosa	Rorug04G0362800
rosa_samantha	Rh4AG424200 Rh4BG436300 Rh4CG450900 Rh4DG432800
rosa_wichuraiana	Rw4G036370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	44
AccB1I	GGYRCC	1 cut(s)	101
AciI	CCGC	3 cut(s)	77, 405, 510
AcoI	YGGCCR	1 cut(s)	78
AcuI	CTGAAG	1 cut(s)	555
AcyI	GRCGYC	1 cut(s)	102
AfaI	GTAC	2 cut(s)	173, 793
AfiI	CCNNNNNNNGG	2 cut(s)	310, 769
AgsI	TTSAA	2 cut(s)	209, 262
AlwNI	CAGNNNCTG	2 cut(s)	328, 707
AoxI	GGCC	5 cut(s)	78, 241, 280, 448, 624
AspLEI	GCGC	1 cut(s)	104
AspS9I	GGNCC	1 cut(s)	281
AsuC2I	CCSGG	1 cut(s)	289
AsuHPI	GGTGA	2 cut(s)	37, 511
BanI	GGYRCC	1 cut(s)	101
BbsI	GAAGAC	1 cut(s)	735
BccI	CCATC	2 cut(s)	494, 761
BceAI	ACGGC	1 cut(s)	115
BcgI	CGANNNNNNTGC	2 cut(s)	649, 683
BcnI	CCSGG	1 cut(s)	289
BfaI	CTAG	1 cut(s)	18
BfmI	CTRYAG	2 cut(s)	432, 592
BfoI	RGCGCY	1 cut(s)	105
Bme1390I	CCNGG	1 cut(s)	289
BmgT120I	GGNCC	1 cut(s)	281
BmiI	GGNNCC	3 cut(s)	103, 567, 685
BmrFI	CCNGG	1 cut(s)	289
BmrI	ACTGGG	1 cut(s)	57
BmsI	GCATC	2 cut(s)	420, 567
BmuI	ACTGGG	1 cut(s)	57
BpiI	GAAGAC	1 cut(s)	735
BpuMI	CCSGG	1 cut(s)	289
BsaHI	GRCGYC	1 cut(s)	102
BsaJI	CCNNGG	4 cut(s)	192, 451, 529, 687
Bsc4I	CCNNNNNNNGG	2 cut(s)	310, 769
Bse1I	ACTGG	4 cut(s)	52, 153, 501, 723
BseDI	CCNNGG	4 cut(s)	192, 451, 529, 687
BseLI	CCNNNNNNNGG	2 cut(s)	310, 769
BseMII	CTCAG	2 cut(s)	348, 747
BseNI	ACTGG	4 cut(s)	52, 153, 501, 723
BsgI	GTGCAG	3 cut(s)	129, 341, 403
BshFI	GGCC	5 cut(s)	80, 243, 282, 450, 626
BshNI	GGYRCC	1 cut(s)	101
BsiSI	CCGG	1 cut(s)	288
BslFI	GGGAC	1 cut(s)	180
BslI	CCNNNNNNNGG	2 cut(s)	310, 769
BsmFI	GGGAC	1 cut(s)	180
BsmI	GAATGC	1 cut(s)	534
BsnI	GGCC	5 cut(s)	80, 243, 282, 450, 626
Bsp19I	CCATGG	2 cut(s)	529, 687
BspACI	CCGC	3 cut(s)	77, 405, 510
BspANI	GGCC	5 cut(s)	80, 243, 282, 450, 626
BspCNI	CTCAG	2 cut(s)	347, 746
BspLI	GGNNCC	3 cut(s)	103, 567, 685
BspMAI	CTGCAG	1 cut(s)	436
BspT107I	GGYRCC	1 cut(s)	101
BsrI	ACTGG	4 cut(s)	52, 153, 501, 723
BssECI	CCNNGG	4 cut(s)	192, 451, 529, 687
BssNI	GRCGYC	1 cut(s)	102
BssT1I	CCWWGG	4 cut(s)	192, 451, 529, 687
Bst4CI	ACNGT	3 cut(s)	171, 182, 548
BstACI	GRCGYC	1 cut(s)	102
BstAPI	GCANNNNNTGC	3 cut(s)	328, 417, 707
BstC8I	GCNNGC	5 cut(s)	225, 245, 462, 624, 661
BstDEI	CTNAG	2 cut(s)	334, 733
BstDSI	CCRYGG	2 cut(s)	529, 687
BstH2I	RGCGCY	1 cut(s)	105
BstHHI	GCGC	1 cut(s)	104
BstMWI	GCNNNNNNNGC	8 cut(s)	77, 149, 328, 380, 417, 426, 656, 707
BstNSI	RCATGY	2 cut(s)	464, 516
BstSCI	CCNGG	1 cut(s)	287
BstSFI	CTRYAG	2 cut(s)	432, 592
BstV2I	GAAGAC	1 cut(s)	735
BsuRI	GGCC	5 cut(s)	80, 243, 282, 450, 626
BtgI	CCRYGG	2 cut(s)	529, 687
BtsI	GCAGTG	1 cut(s)	429
BtsIMutI	CAGTG	4 cut(s)	146, 178, 429, 730
Cac8I	GCNNGC	5 cut(s)	225, 245, 462, 624, 661
CaiI	CAGNNNCTG	2 cut(s)	328, 707
CfoI	GCGC	1 cut(s)	104
Cfr13I	GGNCC	1 cut(s)	281
Csp6I	GTAC	2 cut(s)	172, 792
CviQI	GTAC	2 cut(s)	172, 792
DdeI	CTNAG	2 cut(s)	334, 733
DinI	GGCGCC	1 cut(s)	103
DraI	TTTAAA	1 cut(s)	9
EaeI	YGGCCR	1 cut(s)	78
Eco130I	CCWWGG	4 cut(s)	192, 451, 529, 687
Eco147I	AGGCCT	1 cut(s)	450
Eco57I	CTGAAG	1 cut(s)	555
EcoT14I	CCWWGG	4 cut(s)	192, 451, 529, 687
EgeI	GGCGCC	1 cut(s)	103
EheI	GGCGCC	1 cut(s)	103
ErhI	CCWWGG	4 cut(s)	192, 451, 529, 687
FaqI	GGGAC	1 cut(s)	180
FauI	CCCGC	1 cut(s)	398
FspBI	CTAG	1 cut(s)	18
GlaI	GCGC	1 cut(s)	103
HaeII	RGCGCY	1 cut(s)	105
HaeIII	GGCC	5 cut(s)	80, 243, 282, 450, 626
HapII	CCGG	1 cut(s)	288
HhaI	GCGC	1 cut(s)	104
Hin1I	GRCGYC	1 cut(s)	102
Hin6I	GCGC	1 cut(s)	102
HinP1I	GCGC	1 cut(s)	102
HinfI	GANTC	7 cut(s)	155, 197, 209, 482, 525, 601, 731
HpaII	CCGG	1 cut(s)	288
HphI	GGTGA	2 cut(s)	37, 511
Hpy166II	GTNNAC	4 cut(s)	28, 340, 356, 544
Hpy188I	TCNGA	3 cut(s)	202, 233, 574
Hpy8I	GTNNAC	4 cut(s)	28, 340, 356, 544
HpyAV	CCTTC	2 cut(s)	228, 579
HpyCH4III	ACNGT	3 cut(s)	171, 182, 548
HpyCH4V	TGCA	9 cut(s)	56, 146, 227, 322, 374, 420, 434, 622, 710
HpyF10VI	GCNNNNNNNGC	8 cut(s)	77, 149, 328, 380, 417, 426, 656, 707
HpyF3I	CTNAG	2 cut(s)	334, 733
Hsp92I	GRCGYC	1 cut(s)	102
HspAI	GCGC	1 cut(s)	102
KasI	GGCGCC	1 cut(s)	101
LmnI	GCTCC	3 cut(s)	68, 140, 408
LweI	GCATC	2 cut(s)	420, 567
MaeI	CTAG	1 cut(s)	18
MboII	GAAGA	3 cut(s)	641, 704, 740
MluCI	AATT	2 cut(s)	10, 812
Mly113I	GGCGCC	1 cut(s)	102
MlyI	GAGTC	3 cut(s)	149, 534, 725
MnlI	CCTC	3 cut(s)	53, 440, 607
MseI	TTAA	2 cut(s)	8, 366
MslI	CAYNNNNRTG	2 cut(s)	183, 539
MspI	CCGG	1 cut(s)	288
MspR9I	CCNGG	1 cut(s)	289
Mva1269I	GAATGC	1 cut(s)	534
MwoI	GCNNNNNNNGC	8 cut(s)	77, 149, 328, 380, 417, 426, 656, 707
NarI	GGCGCC	1 cut(s)	102
NciI	CCSGG	1 cut(s)	289
NcoI	CCATGG	2 cut(s)	529, 687
NlaIV	GGNNCC	3 cut(s)	103, 567, 685
NspI	RCATGY	2 cut(s)	464, 516
PaeI	GCATGC	1 cut(s)	464
PceI	AGGCCT	1 cut(s)	450
PctI	GAATGC	1 cut(s)	534
PfeI	GAWTC	4 cut(s)	197, 209, 482, 601
PfoI	TCCNGGA	1 cut(s)	287
PleI	GAGTC	3 cut(s)	149, 533, 725
PluTI	GGCGCC	1 cut(s)	105
PpsI	GAGTC	3 cut(s)	149, 533, 725
PsiI	TTATAA	1 cut(s)	44
PspN4I	GGNNCC	3 cut(s)	103, 567, 685
PspPI	GGNCC	1 cut(s)	281
PstI	CTGCAG	1 cut(s)	436
PstNI	CAGNNNCTG	2 cut(s)	328, 707
RsaI	GTAC	2 cut(s)	173, 793
RsaNI	GTAC	2 cut(s)	172, 792
RseI	CAYNNNNRTG	2 cut(s)	183, 539
SaqAI	TTAA	2 cut(s)	8, 366
Sau96I	GGNCC	1 cut(s)	281
SchI	GAGTC	3 cut(s)	149, 534, 725
ScrFI	CCNGG	1 cut(s)	289
SfaNI	GCATC	2 cut(s)	420, 567
SfcI	CTRYAG	2 cut(s)	432, 592
SfoI	GGCGCC	1 cut(s)	103
SmiMI	CAYNNNNRTG	2 cut(s)	183, 539
SphI	GCATGC	1 cut(s)	464
Sse9I	AATT	2 cut(s)	10, 812
SseBI	AGGCCT	1 cut(s)	450
SsiI	CCGC	3 cut(s)	77, 405, 510
SspDI	GGCGCC	1 cut(s)	101
SspMI	CTAG	1 cut(s)	18
StuI	AGGCCT	1 cut(s)	450
StyD4I	CCNGG	1 cut(s)	287
StyI	CCWWGG	4 cut(s)	192, 451, 529, 687
TaaI	ACNGT	3 cut(s)	171, 182, 548
TaqI	TCGA	1 cut(s)	538
TasI	AATT	2 cut(s)	10, 812
TatI	WGTACW	1 cut(s)	171
TauI	GCSGC	2 cut(s)	80, 512
TfiI	GAWTC	4 cut(s)	197, 209, 482, 601
Tru1I	TTAA	2 cut(s)	8, 366
Tru9I	TTAA	2 cut(s)	8, 366
TscAI	CASTG	4 cut(s)	153, 185, 436, 730
TspDTI	ATGAA	2 cut(s)	730, 793
TspRI	CASTG	4 cut(s)	153, 185, 436, 730
XceI	RCATGY	2 cut(s)	464, 516
XcmI	CCANNNNNNNNNTGG	2 cut(s)	307, 493
XspI	CTAG	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.