Rmu_ssc0000107.1_g000001

Short-chain dehydrogenase reductase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000107.1
Physical Location & Seq
Reverse (-)
781 .. 1611
831 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000107.1_g000001.1.cds

Sequence Viewer

Length: 831 bp
atggttttaaattgtgctaggttggtgaacaaagtcgcagttataactgggggtgcaagagggattggagctgctgcggccaagctatttgcccgaaacggcgcccatgttgtgattgccgacatacttgacgatttgggagctgcactggctgactctattgggggacagtacatacactgtgatgtgtccaaggaatctgatgttgaatcagctattgagcttgcactcggaaggacaggccagcttgacatcatgttcaacaatgctggtatttctggcccgtccgggagtataaccagccttgacatgggaaaggtgcagcaactgctctcagtaaacactttcggctgtttacatgggattaagtatgcagcagcagctatgctcaaaaccagaacaggcgggagcatcatctgcacatcaagcactgcagctatcatgggaggccttggtgggcatgcctacacattgtcaaaggaatccatcaatggactggtgagaagtgccgcatgtgagttgggagtccatggcattcgagtgaacagtatttctccacacggggttccttcagagatgctggtcgctgcctacagagagattcttgggaaagaggatatgcaggccgaagatgtaagcaagattgtggcagacagggcgagcttgttgcgtggcagatgtggaaccatggaagatgtcgcagaagctgcattattccttgccagtgaagactcagggttcataacagcccataatcttgtccttgatgggggttatacttctgctgtcagtaccatgagcttcatttatcaatttaccaatagacaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

276

Amino Acids

28.58

Weight (kDa)

5.78

Isoelectric Point (pI)

27.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015203)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G42960
fragaria_vesca FvH4_4g35960
malus_domestica MD13G1013400.v1.1 MD16G1010300.v1.1
prunus_persica Prupe.1G340300_v2.0.a1
pyrus_communis pycom16g01010
rosa_laevigata RLG00000005727
rosa_multiflora Rmu_ssc0000107.1_g000001 Rmu_ssc0000253.1_g000009
rosa_roxburghii Rroxscaffold_5G00386070
rosa_rugosa Rorug04G0362800
rosa_samantha Rh4AG424200 Rh4BG436300 Rh4CG450900 Rh4DG432800
rosa_wichuraiana Rw4G036370

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 44
AccB1I GGYRCC 1 cut(s) 101
AciI CCGC 3 cut(s) 77, 405, 510
AcoI YGGCCR 1 cut(s) 78
AcuI CTGAAG 1 cut(s) 555
AcyI GRCGYC 1 cut(s) 102
AfaI GTAC 2 cut(s) 173, 793
AfiI CCNNNNNNNGG 2 cut(s) 310, 769
AgsI TTSAA 2 cut(s) 209, 262
AlwNI CAGNNNCTG 2 cut(s) 328, 707
AoxI GGCC 5 cut(s) 78, 241, 280, 448, 624
AspLEI GCGC 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 281
AsuC2I CCSGG 1 cut(s) 289
AsuHPI GGTGA 2 cut(s) 37, 511
BanI GGYRCC 1 cut(s) 101
BbsI GAAGAC 1 cut(s) 735
BccI CCATC 2 cut(s) 494, 761
BceAI ACGGC 1 cut(s) 115
BcgI CGANNNNNNTGC 2 cut(s) 649, 683
BcnI CCSGG 1 cut(s) 289
BfaI CTAG 1 cut(s) 18
BfmI CTRYAG 2 cut(s) 432, 592
BfoI RGCGCY 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 289
BmgT120I GGNCC 1 cut(s) 281
BmiI GGNNCC 3 cut(s) 103, 567, 685
BmrFI CCNGG 1 cut(s) 289
BmrI ACTGGG 1 cut(s) 57
BmsI GCATC 2 cut(s) 420, 567
BmuI ACTGGG 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 735
BpuMI CCSGG 1 cut(s) 289
BsaHI GRCGYC 1 cut(s) 102
BsaJI CCNNGG 4 cut(s) 192, 451, 529, 687
Bsc4I CCNNNNNNNGG 2 cut(s) 310, 769
Bse1I ACTGG 4 cut(s) 52, 153, 501, 723
BseDI CCNNGG 4 cut(s) 192, 451, 529, 687
BseLI CCNNNNNNNGG 2 cut(s) 310, 769
BseMII CTCAG 2 cut(s) 348, 747
BseNI ACTGG 4 cut(s) 52, 153, 501, 723
BsgI GTGCAG 3 cut(s) 129, 341, 403
BshFI GGCC 5 cut(s) 80, 243, 282, 450, 626
BshNI GGYRCC 1 cut(s) 101
BsiSI CCGG 1 cut(s) 288
BslFI GGGAC 1 cut(s) 180
BslI CCNNNNNNNGG 2 cut(s) 310, 769
BsmFI GGGAC 1 cut(s) 180
BsmI GAATGC 1 cut(s) 534
BsnI GGCC 5 cut(s) 80, 243, 282, 450, 626
Bsp19I CCATGG 2 cut(s) 529, 687
BspACI CCGC 3 cut(s) 77, 405, 510
BspANI GGCC 5 cut(s) 80, 243, 282, 450, 626
BspCNI CTCAG 2 cut(s) 347, 746
BspLI GGNNCC 3 cut(s) 103, 567, 685
BspMAI CTGCAG 1 cut(s) 436
BspT107I GGYRCC 1 cut(s) 101
BsrI ACTGG 4 cut(s) 52, 153, 501, 723
BssECI CCNNGG 4 cut(s) 192, 451, 529, 687
BssNI GRCGYC 1 cut(s) 102
BssT1I CCWWGG 4 cut(s) 192, 451, 529, 687
Bst4CI ACNGT 3 cut(s) 171, 182, 548
BstACI GRCGYC 1 cut(s) 102
BstAPI GCANNNNNTGC 3 cut(s) 328, 417, 707
BstC8I GCNNGC 5 cut(s) 225, 245, 462, 624, 661
BstDEI CTNAG 2 cut(s) 334, 733
BstDSI CCRYGG 2 cut(s) 529, 687
BstH2I RGCGCY 1 cut(s) 105
BstHHI GCGC 1 cut(s) 104
BstMWI GCNNNNNNNGC 8 cut(s) 77, 149, 328, 380, 417, 426, 656, 707
BstNSI RCATGY 2 cut(s) 464, 516
BstSCI CCNGG 1 cut(s) 287
BstSFI CTRYAG 2 cut(s) 432, 592
BstV2I GAAGAC 1 cut(s) 735
BsuRI GGCC 5 cut(s) 80, 243, 282, 450, 626
BtgI CCRYGG 2 cut(s) 529, 687
BtsI GCAGTG 1 cut(s) 429
BtsIMutI CAGTG 4 cut(s) 146, 178, 429, 730
Cac8I GCNNGC 5 cut(s) 225, 245, 462, 624, 661
CaiI CAGNNNCTG 2 cut(s) 328, 707
CfoI GCGC 1 cut(s) 104
Cfr13I GGNCC 1 cut(s) 281
Csp6I GTAC 2 cut(s) 172, 792
CviQI GTAC 2 cut(s) 172, 792
DdeI CTNAG 2 cut(s) 334, 733
DinI GGCGCC 1 cut(s) 103
DraI TTTAAA 1 cut(s) 9
EaeI YGGCCR 1 cut(s) 78
Eco130I CCWWGG 4 cut(s) 192, 451, 529, 687
Eco147I AGGCCT 1 cut(s) 450
Eco57I CTGAAG 1 cut(s) 555
EcoT14I CCWWGG 4 cut(s) 192, 451, 529, 687
EgeI GGCGCC 1 cut(s) 103
EheI GGCGCC 1 cut(s) 103
ErhI CCWWGG 4 cut(s) 192, 451, 529, 687
FaqI GGGAC 1 cut(s) 180
FauI CCCGC 1 cut(s) 398
FspBI CTAG 1 cut(s) 18
GlaI GCGC 1 cut(s) 103
HaeII RGCGCY 1 cut(s) 105
HaeIII GGCC 5 cut(s) 80, 243, 282, 450, 626
HapII CCGG 1 cut(s) 288
HhaI GCGC 1 cut(s) 104
Hin1I GRCGYC 1 cut(s) 102
Hin6I GCGC 1 cut(s) 102
HinP1I GCGC 1 cut(s) 102
HinfI GANTC 7 cut(s) 155, 197, 209, 482, 525, 601, 731
HpaII CCGG 1 cut(s) 288
HphI GGTGA 2 cut(s) 37, 511
Hpy166II GTNNAC 4 cut(s) 28, 340, 356, 544
Hpy188I TCNGA 3 cut(s) 202, 233, 574
Hpy8I GTNNAC 4 cut(s) 28, 340, 356, 544
HpyAV CCTTC 2 cut(s) 228, 579
HpyCH4III ACNGT 3 cut(s) 171, 182, 548
HpyCH4V TGCA 9 cut(s) 56, 146, 227, 322, 374, 420, 434, 622, 710
HpyF10VI GCNNNNNNNGC 8 cut(s) 77, 149, 328, 380, 417, 426, 656, 707
HpyF3I CTNAG 2 cut(s) 334, 733
Hsp92I GRCGYC 1 cut(s) 102
HspAI GCGC 1 cut(s) 102
KasI GGCGCC 1 cut(s) 101
LmnI GCTCC 3 cut(s) 68, 140, 408
LweI GCATC 2 cut(s) 420, 567
MaeI CTAG 1 cut(s) 18
MboII GAAGA 3 cut(s) 641, 704, 740
MluCI AATT 2 cut(s) 10, 812
Mly113I GGCGCC 1 cut(s) 102
MlyI GAGTC 3 cut(s) 149, 534, 725
MnlI CCTC 3 cut(s) 53, 440, 607
MseI TTAA 2 cut(s) 8, 366
MslI CAYNNNNRTG 2 cut(s) 183, 539
MspI CCGG 1 cut(s) 288
MspR9I CCNGG 1 cut(s) 289
Mva1269I GAATGC 1 cut(s) 534
MwoI GCNNNNNNNGC 8 cut(s) 77, 149, 328, 380, 417, 426, 656, 707
NarI GGCGCC 1 cut(s) 102
NciI CCSGG 1 cut(s) 289
NcoI CCATGG 2 cut(s) 529, 687
NlaIV GGNNCC 3 cut(s) 103, 567, 685
NspI RCATGY 2 cut(s) 464, 516
PaeI GCATGC 1 cut(s) 464
PceI AGGCCT 1 cut(s) 450
PctI GAATGC 1 cut(s) 534
PfeI GAWTC 4 cut(s) 197, 209, 482, 601
PfoI TCCNGGA 1 cut(s) 287
PleI GAGTC 3 cut(s) 149, 533, 725
PluTI GGCGCC 1 cut(s) 105
PpsI GAGTC 3 cut(s) 149, 533, 725
PsiI TTATAA 1 cut(s) 44
PspN4I GGNNCC 3 cut(s) 103, 567, 685
PspPI GGNCC 1 cut(s) 281
PstI CTGCAG 1 cut(s) 436
PstNI CAGNNNCTG 2 cut(s) 328, 707
RsaI GTAC 2 cut(s) 173, 793
RsaNI GTAC 2 cut(s) 172, 792
RseI CAYNNNNRTG 2 cut(s) 183, 539
SaqAI TTAA 2 cut(s) 8, 366
Sau96I GGNCC 1 cut(s) 281
SchI GAGTC 3 cut(s) 149, 534, 725
ScrFI CCNGG 1 cut(s) 289
SfaNI GCATC 2 cut(s) 420, 567
SfcI CTRYAG 2 cut(s) 432, 592
SfoI GGCGCC 1 cut(s) 103
SmiMI CAYNNNNRTG 2 cut(s) 183, 539
SphI GCATGC 1 cut(s) 464
Sse9I AATT 2 cut(s) 10, 812
SseBI AGGCCT 1 cut(s) 450
SsiI CCGC 3 cut(s) 77, 405, 510
SspDI GGCGCC 1 cut(s) 101
SspMI CTAG 1 cut(s) 18
StuI AGGCCT 1 cut(s) 450
StyD4I CCNGG 1 cut(s) 287
StyI CCWWGG 4 cut(s) 192, 451, 529, 687
TaaI ACNGT 3 cut(s) 171, 182, 548
TaqI TCGA 1 cut(s) 538
TasI AATT 2 cut(s) 10, 812
TatI WGTACW 1 cut(s) 171
TauI GCSGC 2 cut(s) 80, 512
TfiI GAWTC 4 cut(s) 197, 209, 482, 601
Tru1I TTAA 2 cut(s) 8, 366
Tru9I TTAA 2 cut(s) 8, 366
TscAI CASTG 4 cut(s) 153, 185, 436, 730
TspDTI ATGAA 2 cut(s) 730, 793
TspRI CASTG 4 cut(s) 153, 185, 436, 730
XceI RCATGY 2 cut(s) 464, 516
XcmI CCANNNNNNNNNTGG 2 cut(s) 307, 493
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.