Rmu_ssc0000135.1_g000035

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000135.1
Physical Location & Seq
Forward (+)
174447 .. 183948
9502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000135.1_g000035.1.cds

Sequence Viewer

Length: 5025 bp
atgggcgaacatgaagggtgggcacagccagcaagtgggctattgctgaatggcctattgcccaatgaagccgcctccgtgatgcgagtgctggattccgagcgatggaccaaggcggaggagagaactgcggagcttattgcctgcattcagcccaatccaccctcagaagagcgcagaattgccgttgctgattatgtgcagcggcttatcctgaagtgcttcccatgccaggtgttcacttttgggtctgtgcccctcaagacttatctgcctgatggagatattgacctcacagccttcagcaagactcaaagtttgaaagactcatgggcccatcaggttcgtgatacgctggagaatgaggagaagaatgagaatgctgaatttcgtgtcaaagaggttcaatacattcaagctgaagtaaagataatcaagtgccttgtggaaaacattgtagtagacatatcctttaatcagctgggaggcttgtgcaccctttgtttccttgaggaggtcgatcatctcataaatcaaaatcatttgttcaagcgtagtattatactgataaaggcctggtgttattatgagagccgaatactaggcgctcaccatggacttatctccacctatgctttggaaacattggttttatacatttttcatgttttcaacaactcctttgctggaccacttgaggtcttgtatcgctttctagagttctttagtaagtttgactgggagaacttttgtgttagcttaaggggtcctgtgcccattagttctcttccagatgtaactgccgaacctcctcgaaaagatggtggagagttactactaagcgaagtgtttcttgatgcgtgtagcgcagtgtatgctgtccgccctggtggtcaagaaaatcagggccaagcttttgtttccaaacattttaatgttattgatcctttgagaatcaacaacaaccttggacgtagtgttagtaaagggtgggcacagccagcaagtgggctattgctgaatggcctattgcccaatgaagccgcctccgtgatgcgagtgctggattccgagcgatggaccaaggcggaggagagaactgcggagcttattgcctgcattcagcccaatccaccctcagaagagcgcagaattgccgttgctgattatgtgcagcggcttatcctgaagtgcttcccatgccaggtgttcacttttgggtctgtgcccctcaagacttatctgcctgatggagatattgacctcacagccttcagcaagactcaaagtttgaaagactcatgggcccatcaggttcgtgatacgctggagaatgaggagaagaatgagaatgctgaatttcgtgtcaaagaggttcaatacattcaagctgaagtaaagataatcaagtgccttgtggaaaacattgtagtagacatatcctttaatcagctgggaggcttgtgcaccctttgtttccttgaggaggtcgatcatctcataaatcaaaatcatttgttcaagcgtagtattatactgataaaggcctggtgttattatgagagccgaatactcggcgctcaccatggacttatctccacctatgctttggaaacattggttttatacatttttcatgttttcaacaactcctttgctggaccacttgaggtcttgtatcgctttctagagttctttagtaagtttgactgggagaacttttgtgttagcttaaggggtcctgtgcccattagttctcttccagatgtaactgccgaacctcctcgaaaagatggtggagagttactactaagcgaagtgtttcttgatgcgtgtagcgcagtgtatgctgtccgccctggtggtcaagaaaatcagggccaagcttttgtttccaaacattttaatgttattgatcctttgagaatcaacaacaaccttggacgtagtgttagtaaaggtaacttctttaggatacgcagtgcatttgcatttggggctaaaaggctggccaggttgcttgattgttcaaaggaggatctatgtttcgaagtaaatcagttttttctcaacacttgggatagacatggaagtggtcatcgacctgatgcaccacgtaatgatcttaggcacttgcgactttcaaatgcagaccacttacatgggtctgagaatcgcaggaacaacttaagcggcaaaaaaaatgaaacttcctctggtcgagatactcaaggtgagggaaaacatggttcacttagtgtttcctctcagcagggtagttatcctatagaaagcatatcacggaacagtgttttttctagtgtaactgatggtcaaagccaaaagaatcacgtgaacatgaacattgggagggcctctgatcagattagaaaggaaatcaatcccgacctgggtgcacatgtggataaaggtcagagaaaaccggatagcttggttaatgaccttcacgggaggtttctttttgcaaggacacgctctagtcctgagcttactgatacatatagtgaagttccctctcaaggtctgcggaatagggccccagagagtgggaaaggccaaacttattccacgaggttggataatagcaggaggaagaaccttgaggctgataatttagcaagccacagatttatatcttcagctgatgatccttcatctgctaaccatattccatcccatcaaagccttgatgttgtggttgattcaaataatagctaccaggatgaatctggttcgagtactgttgctgaagattttccgtctatttcagggacacaagggatgcaccaggaggagcaagatcttgttaacatgatggcatcttctgcagctcatggtttcaatggacaggttcatcttcccctgaatttgggttccggtcatttaccatttccaatcccatcttctgttcttgcttcgatgggatatgctcagaggaatatgggtggcatctttcccacaaattttcccttgatggagagtccttggggaacgaatatgcattttcctcaaggtgttgttccgtcacctttaactcattatttccctggcatggggttgacatcaaatcctgaagaatcggtggaacctggtaatgaagattttggttctgtggagatgaactcaagtgaaactgagcatgatttctggcacaaccaggagaggggatctactagtggatttgatcatgataatggaggtttggaaatgctcgaggcagatgataggcaacagtcaacctcagctggttataactcccatccttcatctcggataggcgctgctgtaagttctatgcgagttcaacaaaagtcccctaaagaaagccgagattcaacgagagaagatcatgtcgatgattttcagtatcaagataaccgaggaaatgaggtatactttgatgaccgagtgagttctaggtcgttgtcggccaattatactagttctgcaagaagcaagacctcctctgagagttcttgggaaggatcatcagcaaaagtgtcaaagtcaacaagggaaaaacggggcagaaaagctgctctgtcaacagctccatctacctcatatgggaaaggtaagagtgtgtctgaacattcttctactcaggcagatgatgaaaacaaagattggaatctgccaacaactttaggtgctgaaatggtagaaagaagcacactatctcaacctgttgcttccttgcctgttccaagacatcaaatgccgggttttgaaccatctcaaacaagtggatcagattcgctgatgcctttcccagttctcttagggcctggctcacgacagagagctacaaatgattctggtgctacctatgcattttatcctacgggacctccagttccatttgttacaatgctaccatattacaatttcccagcagaggcaggaacttcagatgtatcaagccaattcagtagggaagatggacctgaaagtgattctggtcagaactttgattccgctgaaggaattgatcaacctgagttaagaatttctaactccatgggaagggttgctcctattgagccttctgagtataaatctgacatccttcacagtgactttgccagccattatcagaatttgcagtttggacggttatgccaaaatcctcggcattctccacctatggtttatccttcacctgttatggtgccccctgcctacttgcaagggcgatttccttgggatggtcctgggagacctctctcagccaatatgaatctcatcactcagcttatgaattatggccctcgtgttgttcctgttgctgcgcctctccagtctgtttctaacagacctgctagtgtgtatcaacgctatgtcgatgagattccaagataccgcagtgggacagggacctaccttccaaatcctaaggtttctgtaagggaccgccatacttcaagtacaagaagggggagtttcaattatgacagaaatgaccaccatggtgatagagaagggaactggaatgccaactcaaagtcacgagcttctgcacgcaaccacagtcgcagccaagctgagaagccaaattcaagagtagaccgtatggcagctagtgagagccgtgctgagaggccatggagctcacatagacatgattcattcccttcatatcaatctcaaaacggtcctatccgctcaagtactacacagagtggttccactaatgtggcgtatggcatgtatccactaccaggcatgaatcccggtggggtgtcatcaaatggacctaccatgccccctcttgtcatgctatatccttatgatcataatactggctatgggccaccacctgccgaacagctggagtttggttctcttggaccagtgggtttctcaggtttgaatgaagtttcacagttaaatgagggaagtcggatgggtggagtattcgaggaacaaagatttcacggtggctcaactcaacgatcgtcacctgatcagccttcctcaccacacatccaaaggggagtttga

Protein Analysis

1674

Amino Acids

185.77

Weight (kDa)

5.88

Isoelectric Point (pI)

48.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 3273
AarI CACCTGC 1 cut(s) 4849
Acc36I ACCTGC 2 cut(s) 4348, 4849
AccB1I GGYRCC 1 cut(s) 4192
AccB7I CCANNNNNTGG 3 cut(s) 35, 1007, 2567
AccBSI CCGCTC 1 cut(s) 4686
AccI GTMKAC 4 cut(s) 462, 1434, 3414, 4587
AclWI GGATC 7 cut(s) 938, 1910, 2046, 2663, 3196, 3514, 3778
AcoI YGGCCR 2 cut(s) 2010, 3450
AcsI RAATTY 7 cut(s) 386, 1358, 2887, 2983, 4029, 4120, 4576
AcvI CACGTG 1 cut(s) 2353
AdeI CACNNNGTG 2 cut(s) 2258, 4703
AfaI GTAC 3 cut(s) 2761, 4450, 4693
AflII CTTAAG 3 cut(s) 760, 1732, 2188
AflIII ACRYGT 1 cut(s) 2419
AhlI ACTAGT 2 cut(s) 3194, 3461
AjuI GAANNNNNNNTTGG 2 cut(s) 2908, 2940
AleI CACNNNNGTG 2 cut(s) 4491, 4715
AloI GAACNNNNNNTCC 4 cut(s) 3861, 3893, 3980, 4012
Alw21I GWGCWC 4 cut(s) 497, 1469, 2419, 4634
Alw26I GTCTC 1 cut(s) 4234
Alw44I GTGCAC 3 cut(s) 493, 1465, 2415
AlwI GGATC 7 cut(s) 938, 1910, 2046, 2663, 3196, 3514, 3778
Ama87I CYCGRG 1 cut(s) 3233
ApaI GGGCCC 3 cut(s) 337, 1309, 2560
ApaLI GTGCAC 3 cut(s) 493, 1465, 2415
ApeKI GCWGC 8 cut(s) 202, 1174, 2849, 3302, 3557, 4310, 4557, 4598
ApoI RAATTY 7 cut(s) 386, 1358, 2887, 2983, 4029, 4120, 4576
ArsI GACNNNNNNTTYG 4 cut(s) 301, 333, 1273, 1305
Asp700I GAANNNNTTC 5 cut(s) 221, 849, 1193, 1821, 2775
AspLEI GCGC 8 cut(s) 177, 608, 869, 1149, 1580, 1841, 3302, 4315
AsuC2I CCSGG 2 cut(s) 3744, 4755
AsuHPI GGTGA 8 cut(s) 602, 1574, 2246, 3039, 4173, 4505, 4974, 4992
AsuII TTCGAA 1 cut(s) 2049
AvaI CYCGRG 1 cut(s) 3233
AxyI CCTNAGG 1 cut(s) 4416
BaeI ACNNNNGTAYC 2 cut(s) 4372, 4405
BalI TGGCCA 1 cut(s) 2012
BanI GGYRCC 1 cut(s) 4192
BanII GRGCYC 4 cut(s) 337, 1309, 2560, 4634
BauI CACGAG 3 cut(s) 2590, 4293, 4530
BbrPI CACGTG 1 cut(s) 2353
Bbv12I GWGCWC 4 cut(s) 497, 1469, 2419, 4634
BbvCI CCTCAGC 1 cut(s) 3262
BbvI GCAGC 8 cut(s) 214, 1186, 2861, 3289, 3544, 4297, 4569, 4610
BceAI ACGGC 3 cut(s) 170, 1142, 4596
BcgI CGANNNNNNTGC 2 cut(s) 2396, 2430
BciVI GTATCC 2 cut(s) 1968, 4743
BclI TGATCA 5 cut(s) 2380, 3205, 4012, 4813, 4987
BcnI CCSGG 2 cut(s) 3744, 4755
BcoDI GTCTC 1 cut(s) 4234
BcuI ACTAGT 2 cut(s) 3194, 3461
BfmI CTRYAG 2 cut(s) 2286, 2847
BfoI RGCGCY 3 cut(s) 609, 1581, 3303
BfrI CTTAAG 3 cut(s) 760, 1732, 2188
BfuAI ACCTGC 2 cut(s) 4348, 4849
BfuI GTATCC 2 cut(s) 1968, 4743
BglII AGATCT 1 cut(s) 2821
BmcAI AGTACT 2 cut(s) 2761, 4693
BmeT110I CYCGRG 1 cut(s) 3233
BmrI ACTGGG 3 cut(s) 748, 1720, 3788
BmsI GCATC 9 cut(s) 72, 847, 1044, 1819, 2098, 2793, 2849, 2979, 3774
BmuI ACTGGG 3 cut(s) 748, 1720, 3788
BplI GAGNNNNNCTC 2 cut(s) 3128, 3160
BpmI CTGGAG 5 cut(s) 377, 1349, 3858, 4304, 4874
Bpu10I CCTNAGC 2 cut(s) 2505, 3262
Bpu14I TTCGAA 1 cut(s) 2049
BpuMI CCSGG 2 cut(s) 3744, 4755
BsaAI YACGTR 2 cut(s) 2117, 2353
BsaBI GATNNNNATC 2 cut(s) 2653, 3651
BsaI GGTCTC 1 cut(s) 4234
BsaWI WCCGGW 2 cut(s) 2443, 2897
BsaXI ACNNNNNCTCC 2 cut(s) 3856, 3886
Bse1I ACTGG 8 cut(s) 743, 1715, 3794, 3875, 4321, 4514, 4828, 4874
Bse21I CCTNAGG 1 cut(s) 4416
Bse8I GATNNNNATC 2 cut(s) 2653, 3651
BseGI GGATG 8 cut(s) 2693, 2749, 2808, 3280, 4086, 4234, 4932, 5007
BseJI GATNNNNATC 2 cut(s) 2653, 3651
BseNI ACTGG 8 cut(s) 743, 1715, 3794, 3875, 4321, 4514, 4828, 4874
BseXI GCAGC 8 cut(s) 214, 1186, 2861, 3289, 3544, 4297, 4569, 4610
BseYI CCCAGC 3 cut(s) 481, 1453, 3913
BsgI GTGCAG 3 cut(s) 221, 1193, 4524
Bsh1285I CGRYCG 1 cut(s) 4979
BshNI GGYRCC 1 cut(s) 4192
BsiEI CGRYCG 1 cut(s) 4979
BsiHKAI GWGCWC 4 cut(s) 497, 1469, 2419, 4634
BsiHKCI CYCGRG 1 cut(s) 3233
BsiSI CCGG 4 cut(s) 2444, 2898, 3743, 4755
BslFI GGGAC 6 cut(s) 2806, 3319, 3882, 4405, 4411, 4445
BsmAI GTCTC 1 cut(s) 4234
BsmFI GGGAC 6 cut(s) 2806, 3319, 3882, 4405, 4411, 4445
BsmI GAATGC 6 cut(s) 147, 385, 1119, 1357, 4156, 4519
Bso31I GGTCTC 1 cut(s) 4234
BsoBI CYCGRG 1 cut(s) 3233
Bsp119I TTCGAA 1 cut(s) 2049
Bsp120I GGGCCC 3 cut(s) 333, 1305, 2556
Bsp19I CCATGG 5 cut(s) 613, 1585, 4041, 4489, 4625
BspHI TCATGA 1 cut(s) 3208
BspMAI CTGCAG 1 cut(s) 2851
BspMI ACCTGC 2 cut(s) 4348, 4849
BspPI GGATC 7 cut(s) 938, 1910, 2046, 2663, 3196, 3514, 3778
BspQI GCTCTTC 2 cut(s) 165, 1137
BspT104I TTCGAA 1 cut(s) 2049
BspT107I GGYRCC 1 cut(s) 4192
BspTI CTTAAG 3 cut(s) 760, 1732, 2188
BspTNI GGTCTC 1 cut(s) 4234
BsrBI CCGCTC 1 cut(s) 4686
BsrI ACTGG 8 cut(s) 743, 1715, 3794, 3875, 4321, 4514, 4828, 4874
BssNAI GTATAC 1 cut(s) 3415
BssSI CACGAG 3 cut(s) 2590, 4293, 4530
Bst1107I GTATAC 1 cut(s) 3415
Bst2BI CACGAG 3 cut(s) 2590, 4293, 4530
Bst6I CTCTTC 4 cut(s) 165, 792, 1137, 1764
BstAFI CTTAAG 3 cut(s) 760, 1732, 2188
BstAPI GCANNNNNTGC 3 cut(s) 875, 1847, 2846
BstBAI YACGTR 2 cut(s) 2117, 2353
BstBI TTCGAA 1 cut(s) 2049
BstC8I GCNNGC 8 cut(s) 30, 145, 1002, 1117, 2010, 2641, 4108, 4543
BstDSI CCRYGG 5 cut(s) 613, 1585, 4041, 4489, 4625
BstENI CCTNNNNNAGG 2 cut(s) 512, 1484
BstF5I GGATG 8 cut(s) 2693, 2749, 2808, 3280, 4086, 4234, 4932, 5007
BstH2I RGCGCY 3 cut(s) 609, 1581, 3303
BstHHI GCGC 8 cut(s) 177, 608, 869, 1149, 1580, 1841, 3302, 4315
BstMAI GTCTC 1 cut(s) 4234
BstMCI CGRYCG 1 cut(s) 4979
BstNSI RCATGY 2 cut(s) 2423, 4732
BstSFI CTRYAG 2 cut(s) 2286, 2847
BstV1I GCAGC 8 cut(s) 214, 1186, 2861, 3289, 3544, 4297, 4569, 4610
BstX2I RGATCY 3 cut(s) 2038, 2821, 3188
BstXI CCANNNNNNTGG 3 cut(s) 2162, 2596, 4717
BstYI RGATCY 3 cut(s) 2038, 2821, 3188
BstZ17I GTATAC 1 cut(s) 3415
Bsu36I CCTNAGG 1 cut(s) 4416
BsuI GTATCC 2 cut(s) 1968, 4743
BtgI CCRYGG 5 cut(s) 613, 1585, 4041, 4489, 4625
BtgZI GCGATG 2 cut(s) 118, 1090
BtsCI GGATG 8 cut(s) 2693, 2749, 2808, 3280, 4086, 4234, 4932, 5007
BtsI GCAGTG 4 cut(s) 876, 1848, 1987, 4393
BtsIMutI CAGTG 7 cut(s) 876, 1848, 1987, 2314, 4102, 4393, 4881
BveI ACCTGC 2 cut(s) 4348, 4849
Cac8I GCNNGC 8 cut(s) 30, 145, 1002, 1117, 2010, 2641, 4108, 4543
CciI TCATGA 1 cut(s) 3208
CfoI GCGC 8 cut(s) 177, 608, 869, 1149, 1580, 1841, 3302, 4315
CsiI ACCWGGT 1 cut(s) 3109
Csp6I GTAC 3 cut(s) 2760, 4449, 4692
CviQI GTAC 3 cut(s) 2760, 4449, 4692
DraIII CACNNNGTG 2 cut(s) 2258, 4703
EaeI YGGCCR 2 cut(s) 2010, 3450
Eam1104I CTCTTC 4 cut(s) 165, 792, 1137, 1764
EarI CTCTTC 4 cut(s) 165, 792, 1137, 1764
EciI GGCGGA 4 cut(s) 131, 872, 1103, 1844
Ecl136II GAGCTC 1 cut(s) 4632
Eco147I AGGCCT 2 cut(s) 575, 1547
Eco24I GRGCYC 4 cut(s) 337, 1309, 2560, 4634
Eco31I GGTCTC 1 cut(s) 4234
Eco53kI GAGCTC 1 cut(s) 4632
Eco72I CACGTG 1 cut(s) 2353
Eco81I CCTNAGG 1 cut(s) 4416
Eco88I CYCGRG 1 cut(s) 3233
EcoICRI GAGCTC 1 cut(s) 4632
EcoNI CCTNNNNNAGG 2 cut(s) 512, 1484
EcoO109I RGGNCCY 8 cut(s) 767, 1739, 2373, 2556, 2557, 3806, 3869, 4398
EcoT22I ATGCAT 2 cut(s) 3024, 3856
EcoT38I GRGCYC 4 cut(s) 337, 1309, 2560, 4634
FalI AAGNNNNNCTT 4 cut(s) 837, 869, 1809, 1841
FaqI GGGAC 6 cut(s) 2806, 3319, 3882, 4405, 4411, 4445
FauNDI CATATG 1 cut(s) 3586
FbaI TGATCA 5 cut(s) 2380, 3205, 4012, 4813, 4987
FblI GTMKAC 4 cut(s) 462, 1434, 3414, 4587
FokI GGATG 8 cut(s) 2680, 2756, 2815, 3267, 4073, 4241, 4939, 4994
FriOI GRGCYC 4 cut(s) 337, 1309, 2560, 4634
GlaI GCGC 8 cut(s) 176, 607, 868, 1148, 1579, 1840, 3301, 4314
GsaI CCCAGC 3 cut(s) 485, 1457, 3917
GsuI CTGGAG 5 cut(s) 377, 1349, 3858, 4304, 4874
HaeII RGCGCY 3 cut(s) 609, 1581, 3303
HapII CCGG 4 cut(s) 2444, 2898, 3743, 4755
HhaI GCGC 8 cut(s) 177, 608, 869, 1149, 1580, 1841, 3302, 4315
Hin6I GCGC 8 cut(s) 175, 606, 867, 1147, 1578, 1839, 3300, 4313
HinP1I GCGC 8 cut(s) 175, 606, 867, 1147, 1578, 1839, 3300, 4313
HincII GTYRAC 5 cut(s) 2830, 3081, 3258, 3531, 3567
HindII GTYRAC 5 cut(s) 2830, 3081, 3258, 3531, 3567
HindIII AAGCTT 2 cut(s) 912, 1884
HpaI GTTAAC 1 cut(s) 2830
HpaII CCGG 4 cut(s) 2444, 2898, 3743, 4755
HphI GGTGA 8 cut(s) 602, 1574, 2246, 3039, 4173, 4505, 4974, 4992
HpyCH4IV ACGT 4 cut(s) 973, 1945, 2116, 2352
HpySE526I ACGT 4 cut(s) 973, 1945, 2116, 2352
HspAI GCGC 8 cut(s) 175, 606, 867, 1147, 1578, 1839, 3300, 4313
Ksp22I TGATCA 5 cut(s) 2380, 3205, 4012, 4813, 4987
KspAI GTTAAC 1 cut(s) 2830
LguI GCTCTTC 2 cut(s) 165, 1137
LmnI GCTCC 6 cut(s) 133, 1105, 2815, 3577, 4060, 4629
Lsp1109I GCAGC 8 cut(s) 214, 1186, 2861, 3289, 3544, 4297, 4569, 4610
LweI GCATC 9 cut(s) 72, 847, 1044, 1819, 2098, 2793, 2849, 2979, 3774
MabI ACCWGGT 1 cut(s) 3109
MaeII ACGT 4 cut(s) 973, 1945, 2116, 2352
MbiI CCGCTC 1 cut(s) 4686
MflI RGATCY 3 cut(s) 2038, 2821, 3188
MlsI TGGCCA 1 cut(s) 2012
MluNI TGGCCA 1 cut(s) 2012
MlyI GAGTC 5 cut(s) 304, 320, 1276, 1292, 3010
MmeI TCCRAC 2 cut(s) 2577, 4904
Mox20I TGGCCA 1 cut(s) 2012
Mph1103I ATGCAT 2 cut(s) 3024, 3856
MroXI GAANNNNTTC 5 cut(s) 221, 849, 1193, 1821, 2775
MscI TGGCCA 1 cut(s) 2012
MslI CAYNNNNRTG 9 cut(s) 933, 1905, 2091, 2160, 3213, 3375, 4491, 4641, 4715
Msp20I TGGCCA 1 cut(s) 2012
MspA1I CMGCKG 8 cut(s) 205, 481, 1177, 1453, 2663, 3266, 4001, 4852
MspCI CTTAAG 3 cut(s) 760, 1732, 2188
MspI CCGG 4 cut(s) 2444, 2898, 3743, 4755
Mva1269I GAATGC 6 cut(s) 147, 385, 1119, 1357, 4156, 4519
NciI CCSGG 2 cut(s) 3744, 4755
NcoI CCATGG 5 cut(s) 613, 1585, 4041, 4489, 4625
NdeI CATATG 1 cut(s) 3586
NmeAIII GCCGAG 3 cut(s) 1554, 3374, 4132
NmuCI GTSAC 4 cut(s) 3045, 4097, 4527, 4980
NsiI ATGCAT 2 cut(s) 3024, 3856
NspI RCATGY 2 cut(s) 2423, 4732
NspV TTCGAA 1 cut(s) 2049
OliI CACNNNNGTG 2 cut(s) 4491, 4715
PaeR7I CTCGAG 1 cut(s) 3233
PagI TCATGA 1 cut(s) 3208
PaqCI CACCTGC 1 cut(s) 4849
PceI AGGCCT 2 cut(s) 575, 1547
PciI ACATGT 1 cut(s) 2419
PciSI GCTCTTC 2 cut(s) 165, 1137
PctI GAATGC 6 cut(s) 147, 385, 1119, 1357, 4156, 4519
PdmI GAANNNNTTC 5 cut(s) 221, 849, 1193, 1821, 2775
PflMI CCANNNNNTGG 3 cut(s) 35, 1007, 2567
Ple19I CGATCG 1 cut(s) 4979
PleI GAGTC 5 cut(s) 304, 320, 1276, 1292, 3009
PmaCI CACGTG 1 cut(s) 2353
PmlI CACGTG 1 cut(s) 2353
PpsI GAGTC 5 cut(s) 304, 320, 1276, 1292, 3009
Ppu21I YACGTR 2 cut(s) 2117, 2353
PpuMI RGGWCCY 4 cut(s) 767, 1739, 3869, 4398
PscI ACATGT 1 cut(s) 2419
PsiI TTATAA 1 cut(s) 3273
Psp124BI GAGCTC 1 cut(s) 4634
Psp5II RGGWCCY 4 cut(s) 767, 1739, 3869, 4398
PspCI CACGTG 1 cut(s) 2353
PspFI CCCAGC 3 cut(s) 481, 1453, 3913
PspOMI GGGCCC 3 cut(s) 333, 1305, 2556
PspPPI RGGWCCY 4 cut(s) 767, 1739, 3869, 4398
PspXI VCTCGAGB 1 cut(s) 3233
PstI CTGCAG 1 cut(s) 2851
PsuI RGATCY 3 cut(s) 2038, 2821, 3188
PvuI CGATCG 1 cut(s) 4979
PvuII CAGCTG 5 cut(s) 481, 1453, 2663, 3266, 4852
RsaI GTAC 3 cut(s) 2761, 4450, 4693
RsaNI GTAC 3 cut(s) 2760, 4449, 4692
RseI CAYNNNNRTG 9 cut(s) 933, 1905, 2091, 2160, 3213, 3375, 4491, 4641, 4715
SacI GAGCTC 1 cut(s) 4634
SapI GCTCTTC 2 cut(s) 165, 1137
ScaI AGTACT 2 cut(s) 2761, 4693
SchI GAGTC 5 cut(s) 304, 320, 1276, 1292, 3010
SexAI ACCWGGT 1 cut(s) 3109
SfaNI GCATC 9 cut(s) 72, 847, 1044, 1819, 2098, 2793, 2849, 2979, 3774
SfcI CTRYAG 2 cut(s) 2286, 2847
Sfr274I CTCGAG 1 cut(s) 3233
SfuI TTCGAA 1 cut(s) 2049
SlaI CTCGAG 1 cut(s) 3233
SmiMI CAYNNNNRTG 9 cut(s) 933, 1905, 2091, 2160, 3213, 3375, 4491, 4641, 4715
SpeI ACTAGT 2 cut(s) 3194, 3461
SseBI AGGCCT 2 cut(s) 575, 1547
SstI GAGCTC 1 cut(s) 4634
StuI AGGCCT 2 cut(s) 575, 1547
TaiI ACGT 4 cut(s) 976, 1948, 2119, 2355
TaqII GACCGA 1 cut(s) 3441
TatI WGTACW 3 cut(s) 2759, 4448, 4691
TauI GCSGC 5 cut(s) 74, 208, 1046, 1180, 2196
TscAI CASTG 7 cut(s) 876, 1848, 1987, 2314, 4102, 4393, 4881
TseFI GTSAC 4 cut(s) 3045, 4097, 4527, 4980
TseI GCWGC 8 cut(s) 202, 1174, 2849, 3302, 3557, 4310, 4557, 4598
Tsp45I GTSAC 4 cut(s) 3045, 4097, 4527, 4980
TspGWI ACGGA 5 cut(s) 67, 1039, 2317, 2769, 3033
TspRI CASTG 7 cut(s) 876, 1848, 1987, 2314, 4102, 4393, 4881
Van91I CCANNNNNTGG 3 cut(s) 35, 1007, 2567
Vha464I CTTAAG 3 cut(s) 760, 1732, 2188
VneI GTGCAC 3 cut(s) 493, 1465, 2415
XagI CCTNNNNNAGG 2 cut(s) 512, 1484
XapI RAATTY 7 cut(s) 386, 1358, 2887, 2983, 4029, 4120, 4576
XbaI TCTAGA 2 cut(s) 715, 1687
XceI RCATGY 2 cut(s) 2423, 4732
XcmI CCANNNNNNNNNTGG 3 cut(s) 634, 1606, 2747
XhoI CTCGAG 1 cut(s) 3233
XmiI GTMKAC 4 cut(s) 462, 1434, 3414, 4587
XmnI GAANNNNTTC 5 cut(s) 221, 849, 1193, 1821, 2775
ZrmI AGTACT 2 cut(s) 2761, 4693
Zsp2I ATGCAT 2 cut(s) 3024, 3856
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.