Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000156.1

Orthogroup ID

OG0003952

Physical Location & Seq

Genomic Coordinates Forward (+)

1172 .. 5247

Gene Structure 4076 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000156.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1143 bp

atgatgaattcaatcgtggagattcatcccaaagaattgaagttcatagttgagttgaagaagcaaagctcatgctcaattcgacttaccaacatgtccgaccaccatgttgcttttaaggttaaaactacatcccccaagaaatactgtgtgcgaccaaatgtaggtgttatcttgccaaaatcagcttgtgaattttcagttacaatgcaagctcaaaagacagctctgcctgacatggattgcagagataagttcttaatccaaagcacaattgtttcttctgggacaactgacgcagatattacagctagcatgtttgctaaagatgagggcaaacacgttgaagagaaaaagctaagggtaatccttatgagcccacctgattcgccaatactgtcaccaatcaaggtagacttgaagcaagggcagggcaatgaagcttcaatactaaatgatcaagtatttggtggagtagaaaccctccctcaacacaaaatggttacaaaggatgtgaagttcagagttgtcaatagtgaggagtcaaagccatcaaaggatactgaggtgaaaccagccaagcatgtggaattgaaactaagaagggaagaggagttgaaaccagcaaaggctgtggaattgaaattaccaaaatatgaggaggtaaaagcaataaatgatgtggagtcaaggccaacatatgctacggacatggaaccagccagagatgtggtgttagaaccagttgatgtggtggaattggaaccagcaaaagatatggagttgaaaccatcaggggatttgcttttgaaactagcaaaagagcaggaggctgataaagcacaggttgtggaaaatttgaagttagttaaagatattgaggagatgaaatcaaagctacttgaacttgaactaaagctgagccaggctgaagttactatctcaaagctaacagaggagaggagttcaagcatcgaagagataaaagatttgcagaagcaattagggcatttgagtaaaggtggtgtgcaacgagtcgagttctctctcctatttggttgcacggtggcactttttagtgttctccttgtgacagctatagctgttaaaagtttgtgcatgaaggtagtatcatccctctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0005886 GO:0006810 GO:0008150 GO:0012505 GO:0016020 GO:0031984 GO:0042175 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0046907 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0071944 GO:0098827

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Motile_Sperm

Protein Analysis

380

Amino Acids

42.32

Weight (kDa)

6.45

Isoelectric Point (pI)

47.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003952)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g04180 FvH4_6g04180 FvH4_6g04180 FvH4_6g04180 FvH4_6g04180 FvH4_6g04180 FvH4_6g04180
malus_domestica	MD00G1052100.v1.1 MD12G1230200.v1.1
prunus_persica	Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335400_v2.0.a1 Prupe.6G335500_v2.0.a1
pyrus_communis	pycom04g19010 pycom12g21400
rosa_chinensis	RchiOBHm_Chr0c30g0501241 RchiOBHm_Chr0c30g0501251 RchiOBHm_Chr3g0452761 RchiOBHm_Chr3g0452781
rosa_laevigata	RLG00000025570
rosa_multiflora	Rmu_ssc0000156.1_g000002
rosa_roxburghii	Rroxscaffold_6G00429760
rosa_rugosa	Rorug02G0643000
rosa_samantha	Rh3AG045200 Rh3BG047700 Rh3CG046200 Rh3DG046500
rosa_wichuraiana	Rw3G003560

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	414
AcsI	RAATTY	3 cut(s)	7, 194, 856
AcuI	CTGAAG	1 cut(s)	951
AfiI	CCNNNNNNNGG	1 cut(s)	164
AflIII	ACRYGT	2 cut(s)	93, 340
AjnI	CCWGG	1 cut(s)	924
AloI	GAACNNNNNNTCC	2 cut(s)	503, 535
AoxI	GGCC	1 cut(s)	692
ApoI	RAATTY	3 cut(s)	7, 194, 856
AsuHPI	GGTGA	2 cut(s)	393, 580
AsuNHI	GCTAGC	1 cut(s)	311
BaeI	ACNNNNGTAYC	2 cut(s)	552, 585
BanII	GRGCYC	1 cut(s)	380
BarI	GAAGNNNNNNTAC	2 cut(s)	432, 464
BccI	CCATC	2 cut(s)	559, 799
BciT130I	CCWGG	1 cut(s)	926
BciVI	GTATCC	1 cut(s)	553
BclI	TGATCA	1 cut(s)	457
BfaI	CTAG	2 cut(s)	312, 815
BfmI	CTRYAG	1 cut(s)	1098
BfuI	GTATCC	1 cut(s)	553
BlpI	GCTNAGC	1 cut(s)	920
Bme1390I	CCNGG	1 cut(s)	926
BmiI	GGNNCC	2 cut(s)	717, 765
BmrFI	CCNGG	1 cut(s)	926
BmsI	GCATC	1 cut(s)	981
BmtI	GCTAGC	1 cut(s)	315
Bpu10I	CCTNAGC	1 cut(s)	359
Bpu1102I	GCTNAGC	1 cut(s)	920
Bsc4I	CCNNNNNNNGG	1 cut(s)	164
Bse1I	ACTGG	1 cut(s)	743
Bse3DI	GCAATG	1 cut(s)	442
BseBI	CCWGG	1 cut(s)	926
BseGI	GGATG	4 cut(s)	25, 131, 517, 1133
BseLI	CCNNNNNNNGG	1 cut(s)	164
BseMI	GCAATG	1 cut(s)	442
BseMII	CTCAG	2 cut(s)	555, 911
BseNI	ACTGG	1 cut(s)	743
BseRI	GAGGAG	6 cut(s)	554, 626, 674, 896, 971, 976
BshFI	GGCC	1 cut(s)	694
BslFI	GGGAC	1 cut(s)	301
BslI	CCNNNNNNNGG	1 cut(s)	164
BsmFI	GGGAC	1 cut(s)	301
BsnI	GGCC	1 cut(s)	694
Bsp1286I	GDGCHC	1 cut(s)	380
Bsp143I	GATC	1 cut(s)	457
Bsp1720I	GCTNAGC	1 cut(s)	920
BspANI	GGCC	1 cut(s)	694
BspCNI	CTCAG	2 cut(s)	556, 912
BspLI	GGNNCC	2 cut(s)	717, 765
BspOI	GCTAGC	1 cut(s)	315
BsrDI	GCAATG	1 cut(s)	442
BsrI	ACTGG	1 cut(s)	743
BssMI	GATC	1 cut(s)	457
Bst2UI	CCWGG	1 cut(s)	926
Bst4CI	ACNGT	3 cut(s)	149, 399, 1066
Bst6I	CTCTTC	3 cut(s)	342, 603, 972
BstC8I	GCNNGC	2 cut(s)	213, 313
BstDEI	CTNAG	4 cut(s)	359, 564, 599, 920
BstF5I	GGATG	4 cut(s)	25, 131, 517, 1133
BstKTI	GATC	1 cut(s)	460
BstMBI	GATC	1 cut(s)	457
BstMWI	GCNNNNNNNGC	2 cut(s)	839, 1006
BstNI	CCWGG	1 cut(s)	926
BstNSI	RCATGY	3 cut(s)	97, 319, 587
BstSCI	CCNGG	1 cut(s)	924
BstSFI	CTRYAG	1 cut(s)	1098
BstXI	CCANNNNNNTGG	2 cut(s)	586, 730
BsuI	GTATCC	1 cut(s)	553
BsuRI	GGCC	1 cut(s)	694
BtsCI	GGATG	4 cut(s)	25, 131, 517, 1133
Cac8I	GCNNGC	2 cut(s)	213, 313
CseI	GACGC	1 cut(s)	305
CspCI	CAANNNNNGTGG	2 cut(s)	615, 650
CviAII	CATG	8 cut(s)	72, 94, 107, 238, 316, 584, 712, 1120
DdeI	CTNAG	4 cut(s)	359, 564, 599, 920
DpnI	GATC	1 cut(s)	459
DpnII	GATC	1 cut(s)	457
Eam1104I	CTCTTC	3 cut(s)	342, 603, 972
EarI	CTCTTC	3 cut(s)	342, 603, 972
Eco24I	GRGCYC	1 cut(s)	380
Eco57I	CTGAAG	1 cut(s)	951
EcoRI	GAATTC	1 cut(s)	7
EcoRII	CCWGG	1 cut(s)	924
EcoT38I	GRGCYC	1 cut(s)	380
FaeI	CATG	8 cut(s)	75, 97, 110, 241, 319, 587, 715, 1123
FalI	AAGNNNNNCTT	2 cut(s)	401, 433
FaqI	GGGAC	1 cut(s)	301
FatI	CATG	8 cut(s)	71, 93, 106, 237, 315, 583, 711, 1119
FauNDI	CATATG	1 cut(s)	700
FbaI	TGATCA	1 cut(s)	457
FblI	GTMKAC	1 cut(s)	414
FokI	GGATG	4 cut(s)	12, 118, 524, 1120
FriOI	GRGCYC	1 cut(s)	380
FspBI	CTAG	2 cut(s)	312, 815
HaeIII	GGCC	1 cut(s)	694
HgaI	GACGC	1 cut(s)	305
Hin1II	CATG	8 cut(s)	75, 97, 110, 241, 319, 587, 715, 1123
HindIII	AAGCTT	1 cut(s)	441
HinfI	GANTC	5 cut(s)	22, 386, 542, 686, 1035
HphI	GGTGA	2 cut(s)	393, 580
Hpy166II	GTNNAC	1 cut(s)	415
Hpy188I	TCNGA	3 cut(s)	100, 524, 1142
Hpy8I	GTNNAC	1 cut(s)	415
HpyAV	CCTTC	2 cut(s)	597, 1117
HpyCH4III	ACNGT	3 cut(s)	149, 399, 1066
HpyCH4IV	ACGT	1 cut(s)	342
HpyCH4V	TGCA	6 cut(s)	211, 246, 994, 1030, 1062, 1119
HpyF10VI	GCNNNNNNNGC	2 cut(s)	839, 1006
HpyF3I	CTNAG	4 cut(s)	359, 564, 599, 920
HpySE526I	ACGT	1 cut(s)	342
Hsp92II	CATG	8 cut(s)	75, 97, 110, 241, 319, 587, 715, 1123
Ksp22I	TGATCA	1 cut(s)	457
Kzo9I	GATC	1 cut(s)	457
LweI	GCATC	1 cut(s)	981
MaeI	CTAG	2 cut(s)	312, 815
MaeII	ACGT	1 cut(s)	342
MaeIII	GTNAC	5 cut(s)	202, 399, 502, 934, 1090
MalI	GATC	1 cut(s)	459
MboI	GATC	1 cut(s)	457
MboII	GAAGA	5 cut(s)	70, 273, 359, 620, 989
MfeI	CAATTG	1 cut(s)	273
MhlI	GDGCHC	1 cut(s)	380
MlyI	GAGTC	3 cut(s)	551, 695, 1044
MmeI	TCCRAC	1 cut(s)	123
MseI	TTAA	5 cut(s)	117, 123, 260, 870, 1107
MspR9I	CCNGG	1 cut(s)	926
MunI	CAATTG	1 cut(s)	273
MvaI	CCWGG	1 cut(s)	926
MwoI	GCNNNNNNNGC	2 cut(s)	839, 1006
NdeI	CATATG	1 cut(s)	700
NdeII	GATC	1 cut(s)	457
NheI	GCTAGC	1 cut(s)	311
NlaIII	CATG	8 cut(s)	75, 97, 110, 241, 319, 587, 715, 1123
NlaIV	GGNNCC	2 cut(s)	717, 765
NmuCI	GTSAC	2 cut(s)	399, 1090
NspI	RCATGY	3 cut(s)	97, 319, 587
PciI	ACATGT	1 cut(s)	93
PfeI	GAWTC	2 cut(s)	22, 386
PleI	GAGTC	3 cut(s)	550, 694, 1043
PpsI	GAGTC	3 cut(s)	550, 694, 1043
PscI	ACATGT	1 cut(s)	93
Psp6I	CCWGG	1 cut(s)	924
PspGI	CCWGG	1 cut(s)	924
PspN4I	GGNNCC	2 cut(s)	717, 765
SaqAI	TTAA	5 cut(s)	117, 123, 260, 870, 1107
Sau3AI	GATC	1 cut(s)	457
SchI	GAGTC	3 cut(s)	551, 695, 1044
ScrFI	CCNGG	1 cut(s)	926
SduI	GDGCHC	1 cut(s)	380
SfaNI	GCATC	1 cut(s)	981
SfcI	CTRYAG	1 cut(s)	1098
SspMI	CTAG	2 cut(s)	312, 815
StyD4I	CCNGG	1 cut(s)	924
TaaI	ACNGT	3 cut(s)	149, 399, 1066
TaiI	ACGT	1 cut(s)	345
TaqI	TCGA	3 cut(s)	82, 975, 1038
TfiI	GAWTC	2 cut(s)	22, 386
Tru1I	TTAA	5 cut(s)	117, 123, 260, 870, 1107
Tru9I	TTAA	5 cut(s)	117, 123, 260, 870, 1107
TseFI	GTSAC	2 cut(s)	399, 1090
Tsp45I	GTSAC	2 cut(s)	399, 1090
TspDTI	ATGAA	6 cut(s)	14, 20, 34, 453, 902, 1136
TspGWI	ACGGA	1 cut(s)	722
XapI	RAATTY	3 cut(s)	7, 194, 856
XceI	RCATGY	3 cut(s)	97, 319, 587
XmiI	GTMKAC	1 cut(s)	414
XspI	CTAG	2 cut(s)	312, 815

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.