Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000177.1

Orthogroup ID

OG0010514

Physical Location & Seq

Genomic Coordinates Reverse (-)

38364 .. 39809

Gene Structure 1446 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000177.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1107 bp

atggcagttaattgtgctacttccaattcccaatatgatcggctcaaagaagttaaagagtttgacgaatcaaagatgggagtaaagggtctctccgactctggcatcacttctattcctcgcttcttcatacatccaccagaaactcttccttgtaataacttgaactctagcaccaacgctacctccatccccctactcgacttagccaacctcaattcccccacccatcgtccccaaatcatccaacagattaaagatgccgcctccacgtggggtttcttccaagtcatcaaccacggtataccagcatcagtcctcgatgagacgatccgaagcatcacagccttccatgaacaacctcacgagatcaaagccaaacactacagacgccaagagctccacggtgtcatgtacactagcaacaatgacttgtaccggagtaaagcggcctcgtggcatgactcccttcaggtgtatacagcaccggaggagatgaaggtggaggatgacatcccagaggtttgccgtaaggaggtgattgcatgggattttcatgcagtcaaagtagccgaggcattatttgagttgttggctgaaggtcttggtttggaagctgggaagttcaaggagttgggttttatgaaagctagattatttttgggtcactgttatccctactgtccgcaaccagatctgacggtgggaatcaaatctcatactgatgccggtttgacggtgttgctgcagaaccaggtcggagggttgcaagtgaagcgagggagtgagtgggtggatgttaagcccgtgcctggggcattgactgttaatattggtgacttcatacagatcatatcaaatggggagtatcaaagcgtggagcatcgagtattggcaaactcatcgaaggaaccaagaatctcagtattgatttttaataacgtggggggttggaaagagtcggaagaatttgggccacttccagaattattatcagcagagaaaccagccctttatcgaggattcactgtgccagagttccttcaaagcttttttagcaaagaattagatggcaaaaacatagtagaaagagttacacttcactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

368

Amino Acids

41.12

Weight (kDa)

5.74

Isoelectric Point (pI)

36.3

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010514)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g05410 FvH4_5g35660 FvH4_6g19290
rosa_chinensis	RchiOBHm_Chr1g0342631 RchiOBHm_Chr3g0474401
rosa_laevigata	RLG00000023926 RLG00000029166
rosa_multiflora	Rmu_co8382017.1_g000001 Rmu_sc0000173.1_g000005 Rmu_ssc0000177.1_g000006
rosa_roxburghii	Rroxscaffold_4G00313130 Rroxscaffold_6G00407210
rosa_rugosa	Rorug01G0147000.1
rosa_samantha	Rh1AG165300 Rh1CG154000 Rh3AG191400 Rh3BG220600 Rh3CG215900 Rh3DG216300
rosa_wichuraiana	Rw1G013720 Rw3G017460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	304, 479
AciI	CCGC	3 cut(s)	264, 449, 686
AclWI	GGATC	1 cut(s)	325
AcsI	RAATTY	1 cut(s)	968
AcuI	CTGAAG	2 cut(s)	455, 618
AcvI	CACGTG	1 cut(s)	273
AcyI	GRCGYC	1 cut(s)	391
AfaI	GTAC	2 cut(s)	416, 437
AfiI	CCNNNNNNNGG	4 cut(s)	273, 535, 812, 813
AgsI	TTSAA	3 cut(s)	166, 628, 1046
AjnI	CCWGG	2 cut(s)	753, 811
AluBI	AGCT	4 cut(s)	400, 617, 650, 1050
AluI	AGCT	4 cut(s)	400, 617, 650, 1050
Alw21I	GWGCWC	1 cut(s)	402
Alw26I	GTCTC	2 cut(s)	95, 320
AlwI	GGATC	1 cut(s)	325
AoxI	GGCC	2 cut(s)	450, 974
ApeKI	GCWGC	1 cut(s)	745
ApoI	RAATTY	1 cut(s)	968
Asp700I	GAANNNNTTC	1 cut(s)	147
AspS9I	GGNCC	1 cut(s)	974
AsuHPI	GGTGA	2 cut(s)	550, 848
BanII	GRGCYC	1 cut(s)	402
BauI	CACGAG	2 cut(s)	365, 454
BbrPI	CACGTG	1 cut(s)	273
Bbv12I	GWGCWC	1 cut(s)	402
BbvI	GCAGC	1 cut(s)	732
BccI	CCATC	4 cut(s)	70, 197, 237, 1064
BceAI	ACGGC	1 cut(s)	513
BcgI	CGANNNNNNTGC	2 cut(s)	885, 919
BciT130I	CCWGG	2 cut(s)	755, 813
BcoDI	GTCTC	2 cut(s)	95, 320
BfaI	CTAG	3 cut(s)	171, 420, 651
BfmI	CTRYAG	2 cut(s)	385, 746
BglII	AGATCT	1 cut(s)	694
BisI	GCNGC	3 cut(s)	264, 450, 746
BlsI	GCNGC	3 cut(s)	265, 451, 747
Bme1390I	CCNGG	2 cut(s)	755, 813
BmgT120I	GGNCC	1 cut(s)	974
BmiI	GGNNCC	1 cut(s)	912
BmrFI	CCNGG	2 cut(s)	755, 813
BmsI	GCATC	6 cut(s)	114, 250, 320, 348, 715, 892
BsaAI	YACGTR	1 cut(s)	273
BsaHI	GRCGYC	1 cut(s)	391
BsaI	GGTCTC	1 cut(s)	95
BsaJI	CCNNGG	4 cut(s)	298, 403, 573, 812
BsaWI	WCCGGW	2 cut(s)	438, 487
BsaXI	ACNNNNNCTCC	2 cut(s)	170, 200
Bsc4I	CCNNNNNNNGG	4 cut(s)	273, 535, 812, 813
Bse118I	RCCGGY	1 cut(s)	728
BseBI	CCWGG	2 cut(s)	755, 813
BseDI	CCNNGG	4 cut(s)	298, 403, 573, 812
BseGI	GGATG	6 cut(s)	133, 189, 243, 513, 514, 802
BseLI	CCNNNNNNNGG	4 cut(s)	273, 535, 812, 813
BseMII	CTCAG	1 cut(s)	936
BseRI	GAGGAG	1 cut(s)	506
BseXI	GCAGC	1 cut(s)	732
BseYI	CCCAGC	1 cut(s)	617
BshFI	GGCC	2 cut(s)	452, 976
BsiHKAI	GWGCWC	1 cut(s)	402
BsiSI	CCGG	3 cut(s)	439, 488, 729
BslFI	GGGAC	1 cut(s)	219
BslI	CCNNNNNNNGG	4 cut(s)	273, 535, 812, 813
BsmAI	GTCTC	2 cut(s)	95, 320
BsmBI	CGTCTC	1 cut(s)	320
BsmFI	GGGAC	1 cut(s)	219
BsnI	GGCC	2 cut(s)	452, 976
Bso31I	GGTCTC	1 cut(s)	95
Bsp1286I	GDGCHC	1 cut(s)	402
Bsp1407I	TGTACA	1 cut(s)	414
Bsp143I	GATC	5 cut(s)	37, 330, 369, 694, 849
BspACI	CCGC	3 cut(s)	264, 449, 686
BspANI	GGCC	2 cut(s)	452, 976
BspCNI	CTCAG	1 cut(s)	935
BspLI	GGNNCC	1 cut(s)	912
BspMAI	CTGCAG	1 cut(s)	750
BspPI	GGATC	1 cut(s)	325
BspTNI	GGTCTC	1 cut(s)	95
BsrFI	RCCGGY	1 cut(s)	728
BsrGI	TGTACA	1 cut(s)	414
BssAI	RCCGGY	1 cut(s)	728
BssECI	CCNNGG	4 cut(s)	298, 403, 573, 812
BssMI	GATC	5 cut(s)	37, 330, 369, 694, 849
BssNAI	GTATAC	2 cut(s)	305, 480
BssNI	GRCGYC	1 cut(s)	391
BssSI	CACGAG	2 cut(s)	365, 454
Bst1107I	GTATAC	2 cut(s)	305, 480
Bst2BI	CACGAG	2 cut(s)	365, 454
Bst2UI	CCWGG	2 cut(s)	755, 813
Bst4CI	ACNGT	8 cut(s)	302, 407, 671, 683, 703, 739, 826, 1030
Bst6I	CTCTTC	1 cut(s)	153
BstACI	GRCGYC	1 cut(s)	391
BstAUI	TGTACA	1 cut(s)	414
BstBAI	YACGTR	1 cut(s)	273
BstDEI	CTNAG	2 cut(s)	205, 922
BstDSI	CCRYGG	2 cut(s)	298, 403
BstF5I	GGATG	6 cut(s)	133, 189, 243, 513, 514, 802
BstKTI	GATC	5 cut(s)	40, 333, 372, 697, 852
BstMAI	GTCTC	2 cut(s)	95, 320
BstMBI	GATC	5 cut(s)	37, 330, 369, 694, 849
BstMWI	GCNNNNNNNGC	2 cut(s)	775, 1056
BstNI	CCWGG	2 cut(s)	755, 813
BstSCI	CCNGG	2 cut(s)	753, 811
BstSFI	CTRYAG	2 cut(s)	385, 746
BstV1I	GCAGC	1 cut(s)	732
BstX2I	RGATCY	1 cut(s)	694
BstYI	RGATCY	1 cut(s)	694
BstZ17I	GTATAC	2 cut(s)	305, 480
BsuRI	GGCC	2 cut(s)	452, 976
BtgI	CCRYGG	2 cut(s)	298, 403
BtsCI	GGATG	6 cut(s)	133, 189, 243, 513, 514, 802
BtsIMutI	CAGTG	2 cut(s)	667, 1026
Cfr10I	RCCGGY	1 cut(s)	728
Cfr13I	GGNCC	1 cut(s)	974
CseI	GACGC	1 cut(s)	399
CsiI	ACCWGGT	1 cut(s)	753
Csp6I	GTAC	2 cut(s)	415, 436
CviAII	CATG	5 cut(s)	353, 412, 461, 546, 557
CviQI	GTAC	2 cut(s)	415, 436
DdeI	CTNAG	2 cut(s)	205, 922
DpnI	GATC	5 cut(s)	39, 332, 371, 696, 851
DpnII	GATC	5 cut(s)	37, 330, 369, 694, 849
Eam1104I	CTCTTC	1 cut(s)	153
EarI	CTCTTC	1 cut(s)	153
Ecl136II	GAGCTC	1 cut(s)	400
Eco24I	GRGCYC	1 cut(s)	402
Eco31I	GGTCTC	1 cut(s)	95
Eco53kI	GAGCTC	1 cut(s)	400
Eco57I	CTGAAG	2 cut(s)	455, 618
Eco72I	CACGTG	1 cut(s)	273
EcoICRI	GAGCTC	1 cut(s)	400
EcoRII	CCWGG	2 cut(s)	753, 811
EcoT38I	GRGCYC	1 cut(s)	402
Esp3I	CGTCTC	1 cut(s)	320
FaeI	CATG	5 cut(s)	356, 415, 464, 549, 560
FaqI	GGGAC	1 cut(s)	219
FatI	CATG	5 cut(s)	352, 411, 460, 545, 556
FblI	GTMKAC	2 cut(s)	304, 479
Fnu4HI	GCNGC	3 cut(s)	264, 450, 746
FokI	GGATG	6 cut(s)	120, 176, 230, 500, 521, 809
FriOI	GRGCYC	1 cut(s)	402
Fsp4HI	GCNGC	3 cut(s)	264, 450, 746
FspBI	CTAG	3 cut(s)	171, 420, 651
GluI	GCNGC	3 cut(s)	264, 450, 746
GsaI	CCCAGC	1 cut(s)	621
HaeIII	GGCC	2 cut(s)	452, 976
HapII	CCGG	3 cut(s)	439, 488, 729
HgaI	GACGC	1 cut(s)	399
Hin1I	GRCGYC	1 cut(s)	391
Hin1II	CATG	5 cut(s)	356, 415, 464, 549, 560
HindIII	AAGCTT	1 cut(s)	1048
HinfI	GANTC	7 cut(s)	68, 98, 464, 708, 918, 959, 1023
HpaII	CCGG	3 cut(s)	439, 488, 729
HphI	GGTGA	2 cut(s)	550, 848
Hpy166II	GTNNAC	3 cut(s)	305, 417, 480
Hpy188I	TCNGA	5 cut(s)	97, 335, 699, 761, 964
Hpy188III	TCNNGA	2 cut(s)	365, 983
Hpy8I	GTNNAC	3 cut(s)	305, 417, 480
HpyAV	CCTTC	6 cut(s)	358, 479, 493, 593, 901, 1052
HpyCH4III	ACNGT	8 cut(s)	302, 407, 671, 683, 703, 739, 826, 1030
HpyCH4IV	ACGT	2 cut(s)	272, 942
HpyCH4V	TGCA	4 cut(s)	545, 560, 748, 769
HpyF10VI	GCNNNNNNNGC	2 cut(s)	775, 1056
HpyF3I	CTNAG	2 cut(s)	205, 922
HpySE526I	ACGT	2 cut(s)	272, 942
Hsp92I	GRCGYC	1 cut(s)	391
Hsp92II	CATG	5 cut(s)	356, 415, 464, 549, 560
Kzo9I	GATC	5 cut(s)	37, 330, 369, 694, 849
LmnI	GCTCC	2 cut(s)	405, 880
Lsp1109I	GCAGC	1 cut(s)	732
LweI	GCATC	6 cut(s)	114, 250, 320, 348, 715, 892
MabI	ACCWGGT	1 cut(s)	753
MaeI	CTAG	3 cut(s)	171, 420, 651
MaeII	ACGT	2 cut(s)	272, 942
MaeIII	GTNAC	3 cut(s)	665, 836, 1093
MalI	GATC	5 cut(s)	39, 332, 371, 696, 851
MboI	GATC	5 cut(s)	37, 330, 369, 694, 849
MboII	GAAGA	4 cut(s)	118, 140, 274, 977
MflI	RGATCY	1 cut(s)	694
MhlI	GDGCHC	1 cut(s)	402
MluCI	AATT	6 cut(s)	10, 25, 217, 968, 986, 1064
MlyI	GAGTC	3 cut(s)	92, 458, 968
MmeI	TCCRAC	5 cut(s)	120, 271, 739, 932, 942
MroXI	GAANNNNTTC	1 cut(s)	147
MseI	TTAA	6 cut(s)	9, 54, 255, 801, 828, 936
MslI	CAYNNNNRTG	1 cut(s)	723
MspI	CCGG	3 cut(s)	439, 488, 729
MspR9I	CCNGG	2 cut(s)	755, 813
MvaI	CCWGG	2 cut(s)	755, 813
MwoI	GCNNNNNNNGC	2 cut(s)	775, 1056
NdeII	GATC	5 cut(s)	37, 330, 369, 694, 849
NlaIII	CATG	5 cut(s)	356, 415, 464, 549, 560
NlaIV	GGNNCC	1 cut(s)	912
NmeAIII	GCCGAG	1 cut(s)	598
NmuCI	GTSAC	2 cut(s)	665, 836
PdmI	GAANNNNTTC	1 cut(s)	147
PfeI	GAWTC	4 cut(s)	68, 708, 918, 1023
PkrI	GCNGC	3 cut(s)	265, 451, 747
PleI	GAGTC	3 cut(s)	92, 458, 967
PmaCI	CACGTG	1 cut(s)	273
PmlI	CACGTG	1 cut(s)	273
PpsI	GAGTC	3 cut(s)	92, 458, 967
Ppu21I	YACGTR	1 cut(s)	273
Psp124BI	GAGCTC	1 cut(s)	402
Psp6I	CCWGG	2 cut(s)	753, 811
PspCI	CACGTG	1 cut(s)	273
PspFI	CCCAGC	1 cut(s)	617
PspGI	CCWGG	2 cut(s)	753, 811
PspN4I	GGNNCC	1 cut(s)	912
PspPI	GGNCC	1 cut(s)	974
PstI	CTGCAG	1 cut(s)	750
PsuI	RGATCY	1 cut(s)	694
RsaI	GTAC	2 cut(s)	416, 437
RsaNI	GTAC	2 cut(s)	415, 436
RseI	CAYNNNNRTG	1 cut(s)	723
SacI	GAGCTC	1 cut(s)	402
SaqAI	TTAA	6 cut(s)	9, 54, 255, 801, 828, 936
SatI	GCNGC	3 cut(s)	264, 450, 746
Sau3AI	GATC	5 cut(s)	37, 330, 369, 694, 849
Sau96I	GGNCC	1 cut(s)	974
SchI	GAGTC	3 cut(s)	92, 458, 968
ScrFI	CCNGG	2 cut(s)	755, 813
SduI	GDGCHC	1 cut(s)	402
SexAI	ACCWGGT	1 cut(s)	753
SfaNI	GCATC	6 cut(s)	114, 250, 320, 348, 715, 892
SfcI	CTRYAG	2 cut(s)	385, 746
SmiMI	CAYNNNNRTG	1 cut(s)	723
Sse9I	AATT	6 cut(s)	10, 25, 217, 968, 986, 1064
SsiI	CCGC	3 cut(s)	264, 449, 686
SspI	AATATT	1 cut(s)	832
SspMI	CTAG	3 cut(s)	171, 420, 651
SstI	GAGCTC	1 cut(s)	402
StyD4I	CCNGG	2 cut(s)	753, 811
TaaI	ACNGT	8 cut(s)	302, 407, 671, 683, 703, 739, 826, 1030
TaiI	ACGT	2 cut(s)	275, 945
TaqI	TCGA	5 cut(s)	201, 321, 886, 905, 1018
TasI	AATT	6 cut(s)	10, 25, 217, 968, 986, 1064
TatI	WGTACW	1 cut(s)	414
TauI	GCSGC	2 cut(s)	266, 452
TfiI	GAWTC	4 cut(s)	68, 708, 918, 1023
Tru1I	TTAA	6 cut(s)	9, 54, 255, 801, 828, 936
Tru9I	TTAA	6 cut(s)	9, 54, 255, 801, 828, 936
TscAI	CASTG	2 cut(s)	674, 1033
TseFI	GTSAC	2 cut(s)	665, 836
TseI	GCWGC	1 cut(s)	745
Tsp45I	GTSAC	2 cut(s)	665, 836
TspDTI	ATGAA	6 cut(s)	118, 369, 512, 545, 659, 832
TspRI	CASTG	2 cut(s)	674, 1033
XapI	RAATTY	1 cut(s)	968
XmiI	GTMKAC	2 cut(s)	304, 479
XmnI	GAANNNNTTC	1 cut(s)	147
XspI	CTAG	3 cut(s)	171, 420, 651

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.