Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000257.1

Orthogroup ID

OG0014069

Physical Location & Seq

Genomic Coordinates Reverse (-)

32832 .. 33410

Gene Structure 579 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000257.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 579 bp

atggaacaactctttatagaggctacaataggacatgcactagaggccttattgagagctgtttcacaagccagggacagagcgcacaactatgagtccattcttgcacaacttgaattcacaatccaatccatcgctccaaaaatctatgaaatcgattgtttatctgaagaacatctccaggatgatgtggtccaccgaatatgtctacagctaattcaaggtaaggagttagtcgataagtgttcaaagtcgggttgctgcaccttctacaacagccagaggtactacaagaagctccaagagttggatatttctcttggaaggctgattacgattgacttgcaagttaaggtggcattggatgttgtaaggatttcggctgacatgaaggagctctgtaagagatgggatgatcaagtgaagaatgtacataaagagggaggacagagtacttggattttcaagctaagtggaagaaagcttttgggtaggtttgctggactaaagaagattgtattgtacaaaccaaagagaatccttctgaatttggttacttgtggagctatggaagattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0008150 GO:0009605 GO:0009607 GO:0009620 GO:0043207 GO:0050896 GO:0051704 GO:0051707

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RPW8

Protein Analysis

192

Amino Acids

21.98

Weight (kDa)

8.42

Isoelectric Point (pI)

42.54

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014069)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G50450 AT3G50460 AT3G50470 AT3G50480 AT3G50480
malus_domestica	MD02G1163800.v1.1
prunus_persica	Prupe.7G140100_v2.0.a1
rosa_laevigata	RLG00000017290
rosa_multiflora	Rmu_ssc0000257.1_g000011
rosa_roxburghii	Rroxscaffold_2G00139110
rosa_rugosa	Rorug02G0119300
rosa_samantha	Rh2AG168800 Rh2BG176000 Rh2CG174400 Rh2DG174300 Rh6DG281400
rosa_wichuraiana	Rw2G013210

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	307
AccI	GTMKAC	1 cut(s)	208
AcsI	RAATTY	2 cut(s)	116, 547
AcuI	CTGAAG	1 cut(s)	189
AfaI	GTAC	4 cut(s)	287, 432, 454, 524
AfiI	CCNNNNNNNGG	1 cut(s)	307
AgsI	TTSAA	4 cut(s)	116, 221, 249, 466
AjnI	CCWGG	2 cut(s)	71, 180
AluBI	AGCT	7 cut(s)	59, 214, 298, 397, 469, 484, 566
AluI	AGCT	7 cut(s)	59, 214, 298, 397, 469, 484, 566
Alw21I	GWGCWC	1 cut(s)	399
AoxI	GGCC	1 cut(s)	45
ApeKI	GCWGC	1 cut(s)	261
ApoI	RAATTY	2 cut(s)	116, 547
AspLEI	GCGC	1 cut(s)	85
AspS9I	GGNCC	1 cut(s)	193
AvaII	GGWCC	1 cut(s)	193
BanII	GRGCYC	1 cut(s)	399
BarI	GAAGNNNNNNTAC	2 cut(s)	316, 348
Bbv12I	GWGCWC	1 cut(s)	399
BbvI	GCAGC	1 cut(s)	248
BccI	CCATC	2 cut(s)	140, 402
BcgI	CGANNNNNNTGC	2 cut(s)	325, 359
BciT130I	CCWGG	2 cut(s)	73, 182
BclI	TGATCA	1 cut(s)	415
BfaI	CTAG	1 cut(s)	41
BfmI	CTRYAG	1 cut(s)	209
BisI	GCNGC	1 cut(s)	262
BlsI	GCNGC	1 cut(s)	263
BmcAI	AGTACT	1 cut(s)	454
Bme1390I	CCNGG	2 cut(s)	73, 182
Bme18I	GGWCC	1 cut(s)	193
BmgT120I	GGNCC	1 cut(s)	193
BmrFI	CCNGG	2 cut(s)	73, 182
BpmI	CTGGAG	1 cut(s)	164
Bsa29I	ATCGAT	1 cut(s)	156
BsaJI	CCNNGG	1 cut(s)	72
Bsc4I	CCNNNNNNNGG	1 cut(s)	307
BseBI	CCWGG	2 cut(s)	73, 182
BseCI	ATCGAT	1 cut(s)	156
BseDI	CCNNGG	1 cut(s)	72
BseGI	GGATG	3 cut(s)	190, 370, 418
BseLI	CCNNNNNNNGG	1 cut(s)	307
BseXI	GCAGC	1 cut(s)	248
BsgI	GTGCAG	1 cut(s)	247
BshFI	GGCC	1 cut(s)	47
BshVI	ATCGAT	1 cut(s)	156
BsiHKAI	GWGCWC	1 cut(s)	399
BslFI	GGGAC	1 cut(s)	89
BslI	CCNNNNNNNGG	1 cut(s)	307
BsmFI	GGGAC	1 cut(s)	89
BsnI	GGCC	1 cut(s)	47
Bsp1286I	GDGCHC	1 cut(s)	399
Bsp1407I	TGTACA	2 cut(s)	430, 522
Bsp143I	GATC	1 cut(s)	415
BspANI	GGCC	1 cut(s)	47
BspDI	ATCGAT	1 cut(s)	156
BsrGI	TGTACA	2 cut(s)	430, 522
BssECI	CCNNGG	1 cut(s)	72
BssMI	GATC	1 cut(s)	415
Bst2UI	CCWGG	2 cut(s)	73, 182
BstAUI	TGTACA	2 cut(s)	430, 522
BstDEI	CTNAG	1 cut(s)	470
BstF5I	GGATG	3 cut(s)	190, 370, 418
BstHHI	GCGC	1 cut(s)	85
BstKTI	GATC	1 cut(s)	418
BstMBI	GATC	1 cut(s)	415
BstMWI	GCNNNNNNNGC	1 cut(s)	44
BstNI	CCWGG	2 cut(s)	73, 182
BstNSI	RCATGY	1 cut(s)	38
BstSCI	CCNGG	2 cut(s)	71, 180
BstSFI	CTRYAG	1 cut(s)	209
BstV1I	GCAGC	1 cut(s)	248
Bsu15I	ATCGAT	1 cut(s)	156
BsuRI	GGCC	1 cut(s)	47
BsuTUI	ATCGAT	1 cut(s)	156
BtgZI	GCGATG	1 cut(s)	118
BtsCI	GGATG	3 cut(s)	190, 370, 418
CfoI	GCGC	1 cut(s)	85
Cfr13I	GGNCC	1 cut(s)	193
ClaI	ATCGAT	1 cut(s)	156
Csp6I	GTAC	4 cut(s)	286, 431, 453, 523
CspCI	CAANNNNNGTGG	2 cut(s)	454, 489
CviAII	CATG	2 cut(s)	35, 388
CviQI	GTAC	4 cut(s)	286, 431, 453, 523
DdeI	CTNAG	1 cut(s)	470
DpnI	GATC	1 cut(s)	417
DpnII	GATC	1 cut(s)	415
Ecl136II	GAGCTC	1 cut(s)	397
Eco147I	AGGCCT	1 cut(s)	47
Eco24I	GRGCYC	1 cut(s)	399
Eco47I	GGWCC	1 cut(s)	193
Eco53kI	GAGCTC	1 cut(s)	397
Eco57I	CTGAAG	1 cut(s)	189
EcoICRI	GAGCTC	1 cut(s)	397
EcoRI	GAATTC	1 cut(s)	116
EcoRII	CCWGG	2 cut(s)	71, 180
EcoT38I	GRGCYC	1 cut(s)	399
FaeI	CATG	2 cut(s)	38, 391
FaiI	YATR	8 cut(s)	17, 36, 93, 150, 205, 389, 435, 569
FaqI	GGGAC	1 cut(s)	89
FatI	CATG	2 cut(s)	34, 387
FbaI	TGATCA	1 cut(s)	415
FblI	GTMKAC	1 cut(s)	208
Fnu4HI	GCNGC	1 cut(s)	262
FokI	GGATG	3 cut(s)	197, 377, 425
FriOI	GRGCYC	1 cut(s)	399
Fsp4HI	GCNGC	1 cut(s)	262
FspBI	CTAG	1 cut(s)	41
GlaI	GCGC	1 cut(s)	84
GluI	GCNGC	1 cut(s)	262
GsuI	CTGGAG	1 cut(s)	164
HaeIII	GGCC	1 cut(s)	47
HhaI	GCGC	1 cut(s)	85
Hin1II	CATG	2 cut(s)	38, 391
Hin6I	GCGC	1 cut(s)	83
HinP1I	GCGC	1 cut(s)	83
HindIII	AAGCTT	1 cut(s)	482
HinfI	GANTC	2 cut(s)	95, 537
Hpy166II	GTNNAC	2 cut(s)	196, 209
Hpy188I	TCNGA	2 cut(s)	169, 546
Hpy8I	GTNNAC	2 cut(s)	196, 209
HpyAV	CCTTC	4 cut(s)	277, 318, 385, 551
HpyCH4V	TGCA	4 cut(s)	38, 107, 264, 346
HpyF10VI	GCNNNNNNNGC	1 cut(s)	44
HpyF3I	CTNAG	1 cut(s)	470
Hsp92II	CATG	2 cut(s)	38, 391
HspAI	GCGC	1 cut(s)	83
Ksp22I	TGATCA	1 cut(s)	415
Kzo9I	GATC	1 cut(s)	415
LmnI	GCTCC	4 cut(s)	142, 303, 394, 563
LpnPI	CCDG	6 cut(s)	58, 85, 167, 194, 293, 486
Lsp1109I	GCAGC	1 cut(s)	248
MaeI	CTAG	1 cut(s)	41
MaeIII	GTNAC	1 cut(s)	553
MalI	GATC	1 cut(s)	417
MboI	GATC	1 cut(s)	415
MboII	GAAGA	4 cut(s)	182, 436, 489, 523
MhlI	GDGCHC	1 cut(s)	399
MluCI	AATT	3 cut(s)	116, 216, 547
MlyI	GAGTC	1 cut(s)	104
MmeI	TCCRAC	1 cut(s)	288
MnlI	CCTC	5 cut(s)	13, 37, 276, 433, 437
MseI	TTAA	2 cut(s)	351, 577
MslI	CAYNNNNRTG	1 cut(s)	90
MspR9I	CCNGG	2 cut(s)	73, 182
MvaI	CCWGG	2 cut(s)	73, 182
MwoI	GCNNNNNNNGC	1 cut(s)	44
NdeII	GATC	1 cut(s)	415
NlaIII	CATG	2 cut(s)	38, 391
NspI	RCATGY	1 cut(s)	38
PceI	AGGCCT	1 cut(s)	47
PfeI	GAWTC	1 cut(s)	537
PflMI	CCANNNNNTGG	1 cut(s)	307
PfoI	TCCNGGA	1 cut(s)	180
PkrI	GCNGC	1 cut(s)	263
PleI	GAGTC	1 cut(s)	103
PpsI	GAGTC	1 cut(s)	103
Psp124BI	GAGCTC	1 cut(s)	399
Psp6I	CCWGG	2 cut(s)	71, 180
PspGI	CCWGG	2 cut(s)	71, 180
PspPI	GGNCC	1 cut(s)	193
RsaI	GTAC	4 cut(s)	287, 432, 454, 524
RsaNI	GTAC	4 cut(s)	286, 431, 453, 523
RseI	CAYNNNNRTG	1 cut(s)	90
SacI	GAGCTC	1 cut(s)	399
SaqAI	TTAA	2 cut(s)	351, 577
SatI	GCNGC	1 cut(s)	262
Sau3AI	GATC	1 cut(s)	415
Sau96I	GGNCC	1 cut(s)	193
ScaI	AGTACT	1 cut(s)	454
SchI	GAGTC	1 cut(s)	104
ScrFI	CCNGG	2 cut(s)	73, 182
SduI	GDGCHC	1 cut(s)	399
SfcI	CTRYAG	1 cut(s)	209
SinI	GGWCC	1 cut(s)	193
SmiMI	CAYNNNNRTG	1 cut(s)	90
Sse9I	AATT	3 cut(s)	116, 216, 547
SseBI	AGGCCT	1 cut(s)	47
SspMI	CTAG	1 cut(s)	41
SstI	GAGCTC	1 cut(s)	399
StuI	AGGCCT	1 cut(s)	47
StyD4I	CCNGG	2 cut(s)	71, 180
TaqI	TCGA	2 cut(s)	156, 237
TasI	AATT	3 cut(s)	116, 216, 547
TatI	WGTACW	3 cut(s)	430, 452, 522
TfiI	GAWTC	1 cut(s)	537
Tru1I	TTAA	2 cut(s)	351, 577
Tru9I	TTAA	2 cut(s)	351, 577
TseI	GCWGC	1 cut(s)	261
TspDTI	ATGAA	2 cut(s)	165, 404
Van91I	CCANNNNNTGG	1 cut(s)	307
VpaK11BI	GGWCC	1 cut(s)	193
XapI	RAATTY	2 cut(s)	116, 547
XceI	RCATGY	1 cut(s)	38
XmiI	GTMKAC	1 cut(s)	208
XspI	CTAG	1 cut(s)	41
ZrmI	AGTACT	1 cut(s)	454

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.