Rmu_ssc0000308.1_g000036

ABC transporter F family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000308.1
Physical Location & Seq
Forward (+)
150204 .. 152456
2253 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000308.1_g000036.1.cds

Sequence Viewer

Length: 1008 bp
atgggaaaaaagaagacagatgaagctggtgccgccatgaagggtaagtcaaccggaaaagatgcttctaaagatggaaagaaagtgaaagcaccaacagtctccgccatgttggccaacatggaccagaaacctgagaagcccaagaaggcatcttcctctagtgcaaaggcaaaagtcgctccaaaactttcatcctacactgatggtattgatctccctccctctgatgatgaggtggaagaggaacaacaatccaatcagcaaaggaggtcagaggctaagacgattgatatatccattacagagaaagagttaaaaaaacgtgaaaagaaggaccttcttgctgcccatgctgctgagctgtcaaagaaggaggccctgagagatgatcatgatgctttcactgttgttattggaagcagggcttcagtacttgagggtgaagatgcagatgctaatatcaaggacatatcaatagatagtttttctgtggcggctcgaggaaaggaactactaaagaatacatcagtgaagatatctcatgggaagagatatggtctggttggtccaaatgggatggggaagtctaccctcctgaagcttcttgcttggaggaagattccagtaccaaaaaacatcgatgttcttttagttgaacaggaggtagttggtgatgatagaagtgctctggaagcagttgtttcagctaatgaagaacttgtcaagctccgggaagaggttgcagcattgcagaattcagattctgctcccggtggtgaggaagaggatagtcatgatgatgatgcaggagagaagcttgctgagttgtacgatcaattgcagctgatgggatcggatgctgctgaagcccaggcttcaaagattcttgccggtttgggatttacaaaggatatgcaaggccgccccactaagtcattcagtggtggtagaggcaccagtggtgccacactgatggtgaaaattctcgactttggtgatgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

335

Amino Acids

35.81

Weight (kDa)

5.45

Isoelectric Point (pI)

34.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 29, 956, 965
AccI GTMKAC 1 cut(s) 590
AciI CCGC 4 cut(s) 33, 105, 497, 925
AclWI GGATC 1 cut(s) 862
AcoI YGGCCR 1 cut(s) 114
AcsI RAATTY 2 cut(s) 757, 984
AcuI CTGAAG 3 cut(s) 414, 620, 888
AfaI GTAC 3 cut(s) 435, 630, 833
AfiI CCNNNNNNNGG 1 cut(s) 739
AgsI TTSAA 2 cut(s) 659, 882
AjnI CCWGG 1 cut(s) 873
AluBI AGCT 7 cut(s) 26, 364, 604, 710, 730, 820, 847
AluI AGCT 7 cut(s) 26, 364, 604, 710, 730, 820, 847
Alw21I GWGCWC 1 cut(s) 691
Alw26I GTCTC 1 cut(s) 106
AlwI GGATC 1 cut(s) 862
AlwNI CAGNNNCTG 1 cut(s) 767
Ama87I CYCGRG 1 cut(s) 501
AoxI GGCC 3 cut(s) 114, 378, 922
ApeKI GCWGC 5 cut(s) 347, 356, 746, 844, 863
ApoI RAATTY 2 cut(s) 757, 984
AspS9I GGNCC 4 cut(s) 124, 337, 379, 569
AsuC2I CCSGG 2 cut(s) 734, 774
AsuHPI GGTGA 4 cut(s) 455, 686, 791, 991
AvaI CYCGRG 1 cut(s) 501
AvaII GGWCC 3 cut(s) 124, 337, 569
BalI TGGCCA 1 cut(s) 116
BanI GGYRCC 3 cut(s) 29, 956, 965
BbsI GAAGAC 1 cut(s) 20
Bbv12I GWGCWC 1 cut(s) 691
BbvI GCAGC 5 cut(s) 334, 343, 758, 850, 856
BccI CCATC 5 cut(s) 68, 200, 574, 844, 970
BciT130I CCWGG 1 cut(s) 875
BclI TGATCA 1 cut(s) 391
BcnI CCSGG 2 cut(s) 734, 774
BcoDI GTCTC 1 cut(s) 106
BfaI CTAG 1 cut(s) 162
BglI GCCNNNNNGGC 1 cut(s) 113
BisI GCNGC 8 cut(s) 33, 348, 357, 498, 747, 845, 864, 925
BlpI GCTNAGC 1 cut(s) 360
BlsI GCNGC 8 cut(s) 34, 349, 358, 499, 748, 846, 865, 926
BmcAI AGTACT 1 cut(s) 435
Bme1390I CCNGG 3 cut(s) 734, 774, 875
Bme18I GGWCC 3 cut(s) 124, 337, 569
BmeT110I CYCGRG 1 cut(s) 501
BmgT120I GGNCC 4 cut(s) 124, 337, 379, 569
BmiI GGNNCC 3 cut(s) 31, 958, 967
BmrFI CCNGG 3 cut(s) 734, 774, 875
BmsI GCATC 7 cut(s) 52, 161, 388, 439, 445, 796, 850
BpiI GAAGAC 1 cut(s) 20
Bpu1102I GCTNAGC 1 cut(s) 360
BpuEI CTTGAG 1 cut(s) 458
BpuMI CCSGG 2 cut(s) 734, 774
Bsa29I ATCGAT 1 cut(s) 642
BsaJI CCNNGG 1 cut(s) 873
BsaWI WCCGGW 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 739
Bse118I RCCGGY 1 cut(s) 893
Bse1I ACTGG 2 cut(s) 626, 960
Bse3DI GCAATG 1 cut(s) 749
BseBI CCWGG 1 cut(s) 875
BseCI ATCGAT 1 cut(s) 642
BseDI CCNNGG 1 cut(s) 873
BseGI GGATG 3 cut(s) 194, 585, 865
BseLI CCNNNNNNNGG 1 cut(s) 739
BseMI GCAATG 1 cut(s) 749
BseMII CTCAG 4 cut(s) 126, 351, 374, 816
BseNI ACTGG 2 cut(s) 626, 960
BseXI GCAGC 5 cut(s) 334, 343, 758, 850, 856
BshFI GGCC 3 cut(s) 116, 380, 924
BshNI GGYRCC 3 cut(s) 29, 956, 965
BshVI ATCGAT 1 cut(s) 642
BsiHKAI GWGCWC 1 cut(s) 691
BsiHKCI CYCGRG 1 cut(s) 501
BsiSI CCGG 4 cut(s) 54, 733, 774, 894
BslI CCNNNNNNNGG 1 cut(s) 739
BsmAI GTCTC 1 cut(s) 106
BsnI GGCC 3 cut(s) 116, 380, 924
BsoBI CYCGRG 1 cut(s) 501
Bsp1286I GDGCHC 1 cut(s) 691
Bsp143I GATC 4 cut(s) 214, 391, 835, 854
Bsp1720I GCTNAGC 1 cut(s) 360
BspACI CCGC 4 cut(s) 33, 105, 497, 925
BspANI GGCC 3 cut(s) 116, 380, 924
BspCNI CTCAG 4 cut(s) 127, 352, 375, 817
BspDI ATCGAT 1 cut(s) 642
BspHI TCATGA 2 cut(s) 394, 796
BspLI GGNNCC 3 cut(s) 31, 958, 967
BspPI GGATC 1 cut(s) 862
BspT107I GGYRCC 3 cut(s) 29, 956, 965
BsrDI GCAATG 1 cut(s) 749
BsrFI RCCGGY 1 cut(s) 893
BsrI ACTGG 2 cut(s) 626, 960
BssAI RCCGGY 1 cut(s) 893
BssECI CCNNGG 1 cut(s) 873
BssMI GATC 4 cut(s) 214, 391, 835, 854
Bst2UI CCWGG 1 cut(s) 875
Bst4CI ACNGT 2 cut(s) 100, 409
Bst6I CTCTTC 4 cut(s) 237, 545, 732, 780
BstC8I GCNNGC 1 cut(s) 822
BstDEI CTNAG 6 cut(s) 135, 282, 360, 383, 825, 933
BstF5I GGATG 3 cut(s) 194, 585, 865
BstKTI GATC 4 cut(s) 217, 394, 838, 857
BstMAI GTCTC 1 cut(s) 106
BstMBI GATC 4 cut(s) 214, 391, 835, 854
BstMWI GCNNNNNNNGC 7 cut(s) 32, 113, 179, 353, 356, 695, 869
BstNI CCWGG 1 cut(s) 875
BstSCI CCNGG 3 cut(s) 732, 772, 873
BstV1I GCAGC 5 cut(s) 334, 343, 758, 850, 856
BstV2I GAAGAC 1 cut(s) 20
BstXI CCANNNNNNTGG 1 cut(s) 976
Bsu15I ATCGAT 1 cut(s) 642
BsuRI GGCC 3 cut(s) 116, 380, 924
BsuTUI ATCGAT 1 cut(s) 642
BtsCI GGATG 3 cut(s) 194, 585, 865
BtsIMutI CAGTG 6 cut(s) 201, 405, 537, 949, 967, 971
Cac8I GCNNGC 1 cut(s) 822
CaiI CAGNNNCTG 1 cut(s) 767
CciI TCATGA 2 cut(s) 394, 796
Cfr10I RCCGGY 1 cut(s) 893
Cfr13I GGNCC 4 cut(s) 124, 337, 379, 569
ClaI ATCGAT 1 cut(s) 642
Csp6I GTAC 3 cut(s) 434, 629, 832
CviAII CATG 7 cut(s) 37, 109, 121, 353, 395, 545, 797
CviQI GTAC 3 cut(s) 434, 629, 832
DdeI CTNAG 6 cut(s) 135, 282, 360, 383, 825, 933
DpnI GATC 4 cut(s) 216, 393, 837, 856
DpnII GATC 4 cut(s) 214, 391, 835, 854
EaeI YGGCCR 1 cut(s) 114
Eam1104I CTCTTC 4 cut(s) 237, 545, 732, 780
EarI CTCTTC 4 cut(s) 237, 545, 732, 780
EciI GGCGGA 1 cut(s) 94
Eco32I GATATC 1 cut(s) 540
Eco47I GGWCC 3 cut(s) 124, 337, 569
Eco57I CTGAAG 3 cut(s) 414, 620, 888
Eco88I CYCGRG 1 cut(s) 501
EcoO109I RGGNCCY 2 cut(s) 337, 379
EcoRI GAATTC 1 cut(s) 757
EcoRII CCWGG 1 cut(s) 873
EcoRV GATATC 1 cut(s) 540
FaeI CATG 7 cut(s) 40, 112, 124, 356, 398, 548, 800
FalI AAGNNNNNCTT 2 cut(s) 412, 444
FatI CATG 7 cut(s) 36, 108, 120, 352, 394, 544, 796
FbaI TGATCA 1 cut(s) 391
FblI GTMKAC 1 cut(s) 590
Fnu4HI GCNGC 8 cut(s) 33, 348, 357, 498, 747, 845, 864, 925
FokI GGATG 3 cut(s) 181, 592, 872
Fsp4HI GCNGC 8 cut(s) 33, 348, 357, 498, 747, 845, 864, 925
FspBI CTAG 1 cut(s) 162
GluI GCNGC 8 cut(s) 33, 348, 357, 498, 747, 845, 864, 925
HaeIII GGCC 3 cut(s) 116, 380, 924
HapII CCGG 4 cut(s) 54, 733, 774, 894
Hin1II CATG 7 cut(s) 40, 112, 124, 356, 398, 548, 800
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
HindIII AAGCTT 2 cut(s) 602, 818
HinfI GANTC 3 cut(s) 622, 764, 886
HpaII CCGG 4 cut(s) 54, 733, 774, 894
HphI GGTGA 4 cut(s) 455, 686, 791, 991
Hpy166II GTNNAC 2 cut(s) 51, 591
Hpy188I TCNGA 4 cut(s) 229, 277, 763, 859
Hpy188III TCNNGA 5 cut(s) 395, 598, 692, 797, 989
Hpy8I GTNNAC 2 cut(s) 51, 591
HpyAV CCTTC 5 cut(s) 34, 142, 328, 350, 367
HpyCH4III ACNGT 2 cut(s) 100, 409
HpyCH4IV ACGT 1 cut(s) 325
HpyCH4V TGCA 7 cut(s) 167, 452, 746, 754, 809, 844, 919
HpyF10VI GCNNNNNNNGC 7 cut(s) 32, 113, 179, 353, 356, 695, 869
HpyF3I CTNAG 6 cut(s) 135, 282, 360, 383, 825, 933
HpySE526I ACGT 1 cut(s) 325
Hsp92II CATG 7 cut(s) 40, 112, 124, 356, 398, 548, 800
Ksp22I TGATCA 1 cut(s) 391
Kzo9I GATC 4 cut(s) 214, 391, 835, 854
LmnI GCTCC 3 cut(s) 187, 735, 775
Lsp1109I GCAGC 5 cut(s) 334, 343, 758, 850, 856
LweI GCATC 7 cut(s) 52, 161, 388, 439, 445, 796, 850
MaeI CTAG 1 cut(s) 162
MaeII ACGT 1 cut(s) 325
MalI GATC 4 cut(s) 216, 393, 837, 856
MboI GATC 4 cut(s) 214, 391, 835, 854
MfeI CAATTG 1 cut(s) 839
MhlI GDGCHC 1 cut(s) 691
MlsI TGGCCA 1 cut(s) 116
MluCI AATT 3 cut(s) 757, 839, 984
MluNI TGGCCA 1 cut(s) 116
Mox20I TGGCCA 1 cut(s) 116
MscI TGGCCA 1 cut(s) 116
MseI TTAA 1 cut(s) 317
MslI CAYNNNNRTG 2 cut(s) 801, 974
Msp20I TGGCCA 1 cut(s) 116
MspA1I CMGCKG 1 cut(s) 847
MspI CCGG 4 cut(s) 54, 733, 774, 894
MspR9I CCNGG 3 cut(s) 734, 774, 875
MunI CAATTG 1 cut(s) 839
MvaI CCWGG 1 cut(s) 875
MwoI GCNNNNNNNGC 7 cut(s) 32, 113, 179, 353, 356, 695, 869
NciI CCSGG 2 cut(s) 734, 774
NdeII GATC 4 cut(s) 214, 391, 835, 854
NlaIII CATG 7 cut(s) 40, 112, 124, 356, 398, 548, 800
NlaIV GGNNCC 3 cut(s) 31, 958, 967
PaeR7I CTCGAG 1 cut(s) 501
PagI TCATGA 2 cut(s) 394, 796
PfeI GAWTC 3 cut(s) 622, 764, 886
PfoI TCCNGGA 1 cut(s) 732
PkrI GCNGC 8 cut(s) 34, 349, 358, 499, 748, 846, 865, 926
PpuMI RGGWCCY 1 cut(s) 337
Psp5II RGGWCCY 1 cut(s) 337
Psp6I CCWGG 1 cut(s) 873
PspGI CCWGG 1 cut(s) 873
PspN4I GGNNCC 3 cut(s) 31, 958, 967
PspPI GGNCC 4 cut(s) 124, 337, 379, 569
PspPPI RGGWCCY 1 cut(s) 337
PspXI VCTCGAGB 1 cut(s) 501
PstNI CAGNNNCTG 1 cut(s) 767
PvuII CAGCTG 1 cut(s) 847
RsaI GTAC 3 cut(s) 435, 630, 833
RsaNI GTAC 3 cut(s) 434, 629, 832
RseI CAYNNNNRTG 2 cut(s) 801, 974
SaqAI TTAA 1 cut(s) 317
SatI GCNGC 8 cut(s) 33, 348, 357, 498, 747, 845, 864, 925
Sau3AI GATC 4 cut(s) 214, 391, 835, 854
Sau96I GGNCC 4 cut(s) 124, 337, 379, 569
ScaI AGTACT 1 cut(s) 435
ScrFI CCNGG 3 cut(s) 734, 774, 875
SduI GDGCHC 1 cut(s) 691
SfaNI GCATC 7 cut(s) 52, 161, 388, 439, 445, 796, 850
Sfr274I CTCGAG 1 cut(s) 501
SinI GGWCC 3 cut(s) 124, 337, 569
SlaI CTCGAG 1 cut(s) 501
SmiMI CAYNNNNRTG 2 cut(s) 801, 974
SmlI CTYRAG 2 cut(s) 437, 501
SmoI CTYRAG 2 cut(s) 437, 501
Sse9I AATT 3 cut(s) 757, 839, 984
SsiI CCGC 4 cut(s) 33, 105, 497, 925
SspMI CTAG 1 cut(s) 162
StyD4I CCNGG 3 cut(s) 732, 772, 873
TaaI ACNGT 2 cut(s) 100, 409
TaiI ACGT 1 cut(s) 328
TaqI TCGA 3 cut(s) 502, 642, 990
TasI AATT 3 cut(s) 757, 839, 984
TatI WGTACW 1 cut(s) 433
TauI GCSGC 3 cut(s) 35, 500, 927
TfiI GAWTC 3 cut(s) 622, 764, 886
Tru1I TTAA 1 cut(s) 317
Tru9I TTAA 1 cut(s) 317
TscAI CASTG 6 cut(s) 208, 412, 537, 949, 967, 978
TseI GCWGC 5 cut(s) 347, 356, 746, 844, 863
TspDTI ATGAA 4 cut(s) 36, 53, 183, 729
TspRI CASTG 6 cut(s) 208, 412, 537, 949, 967, 978
VpaK11BI GGWCC 3 cut(s) 124, 337, 569
XapI RAATTY 2 cut(s) 757, 984
XhoI CTCGAG 1 cut(s) 501
XmiI GTMKAC 1 cut(s) 590
XspI CTAG 1 cut(s) 162
ZrmI AGTACT 1 cut(s) 435
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.