Rmu_ssc0000312.1_g000015

RING-like zinc finger

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000312.1
Physical Location & Seq
Reverse (-)
84258 .. 86566
2309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000312.1_g000015.1.cds

Sequence Viewer

Length: 1113 bp
atggatgttccctctccagaaccacatagcgactctcgaagtgaccaatatcctttgctactagagcagatggaaagccccaacagtcatgtgcacgtaattgacgtaacgaggaatgatgatacctcatcaagttcatctaatgatgatcaacctcctagagtggacttgcctcagcatgaagatagactgtcacgtattacacatgcccccacttatcaggctgcttcaacttcgtcaaacagattaagtgctaggagttcatcatttatgaggcggggtgatgggtatagtcgccacagaagaagcccattgaattcaggactgtggatttctgttgaacttcttgtcactatgagtcagataatagcatctattgttgttttgtcattgtcgacaaatgaaaatccgcaagcccctttgttcgcatggattgtgggttatgcatctggctgtgttgcaacactacctattctttactggagattccgtaaccgcaacaggggtgctgagctagaatccactcaatctcatcaagggtcttctgaacgcaatcctcctgaaccaacttcttatacagctatttcaattactccagcttcagacgaagaaagaaatcacactacagaaacagtcatgagaaaccctcaagttgcagaaccctcaagtgcaagacttaatgggttggtggatcatttcaagatggcattagattgcttcttcgcagtctggtttgttgtgggaaatgtgtggatttttggaggtcactcttctccctctgatgctcctaaattgtataggttatgcatagtgttccttacctttagctgtatcggatatgccatgccattcatactgtgtgcaacaatttgttgctgcctgccgtgcatcatctctgtcctgggattccgagaggaccatgctcagactagaggagccaccacagagtcaattaatgctctgccaacctacaaattcaagctgaagagaaatggtatgaatgatgatcaggagagcaacacctctggtgaaggaggactcttggctgcagggacagagaaggagcgtgcaatatcagaagaagatgcggtgagtatgttcggggccttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

370

Amino Acids

40.86

Weight (kDa)

5.57

Isoelectric Point (pI)

52.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 395
AciI CCGC 4 cut(s) 277, 410, 496, 1088
AclWI GGATC 1 cut(s) 699
AcsI RAATTY 2 cut(s) 316, 974
AcuI CTGAAG 2 cut(s) 585, 1004
AfiI CCNNNNNNNGG 1 cut(s) 502
AgsI TTSAA 6 cut(s) 231, 316, 341, 588, 700, 979
AjnI CCWGG 1 cut(s) 900
AluBI AGCT 5 cut(s) 514, 581, 599, 828, 982
AluI AGCT 5 cut(s) 514, 581, 599, 828, 982
Alw21I GWGCWC 1 cut(s) 96
Alw44I GTGCAC 1 cut(s) 92
AlwI GGATC 1 cut(s) 699
AoxI GGCC 1 cut(s) 1104
ApaLI GTGCAC 1 cut(s) 92
ApeKI GCWGC 3 cut(s) 224, 876, 1046
ApoI RAATTY 2 cut(s) 316, 974
AseI ATTAAT 1 cut(s) 954
AspS9I GGNCC 2 cut(s) 916, 1104
AsuHPI GGTGA 3 cut(s) 293, 1040, 1102
AvaII GGWCC 1 cut(s) 916
BaeGI GKGCMC 1 cut(s) 96
BbsI GAAGAC 1 cut(s) 534
Bbv12I GWGCWC 1 cut(s) 96
BbvCI CCTCAGC 1 cut(s) 174
BbvI GCAGC 3 cut(s) 211, 863, 1033
BccI CCATC 3 cut(s) 64, 278, 697
BceAI ACGGC 1 cut(s) 868
BciT130I CCWGG 1 cut(s) 902
BclI TGATCA 2 cut(s) 148, 1006
BfaI CTAG 5 cut(s) 62, 159, 255, 515, 930
BfmI CTRYAG 2 cut(s) 624, 1047
BisI GCNGC 3 cut(s) 225, 877, 1047
BlpI GCTNAGC 1 cut(s) 510
BlsI GCNGC 3 cut(s) 226, 878, 1048
Bme1390I CCNGG 1 cut(s) 902
Bme18I GGWCC 1 cut(s) 916
BmgT120I GGNCC 2 cut(s) 916, 1104
BmiI GGNNCC 2 cut(s) 937, 1105
BmrFI CCNGG 1 cut(s) 902
BmsI GCATC 5 cut(s) 380, 455, 772, 897, 1075
BpiI GAAGAC 1 cut(s) 534
BplI GAGNNNNNCTC 2 cut(s) 631, 663
BpmI CTGGAG 2 cut(s) 502, 579
Bpu10I CCTNAGC 1 cut(s) 174
Bpu1102I GCTNAGC 1 cut(s) 510
BpuEI CTTGAG 2 cut(s) 633, 649
BsaAI YACGTR 2 cut(s) 97, 197
BsaJI CCNNGG 1 cut(s) 901
BsaXI ACNNNNNCTCC 2 cut(s) 475, 505
Bsc4I CCNNNNNNNGG 1 cut(s) 502
Bse1I ACTGG 1 cut(s) 485
BseBI CCWGG 1 cut(s) 902
BseDI CCNNGG 1 cut(s) 901
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 502
BseMII CTCAG 3 cut(s) 188, 501, 938
BseNI ACTGG 1 cut(s) 485
BseRI GAGGAG 1 cut(s) 948
BseSI GKGCMC 1 cut(s) 96
BseXI GCAGC 3 cut(s) 211, 863, 1033
BshFI GGCC 1 cut(s) 1106
BsiHKAI GWGCWC 1 cut(s) 96
BslFI GGGAC 1 cut(s) 1066
BslI CCNNNNNNNGG 1 cut(s) 502
BsmFI GGGAC 1 cut(s) 1066
BsnI GGCC 1 cut(s) 1106
Bsp1286I GDGCHC 1 cut(s) 96
Bsp143I GATC 3 cut(s) 148, 691, 1006
Bsp1720I GCTNAGC 1 cut(s) 510
BspACI CCGC 4 cut(s) 277, 410, 496, 1088
BspANI GGCC 1 cut(s) 1106
BspCNI CTCAG 3 cut(s) 187, 502, 937
BspHI TCATGA 1 cut(s) 636
BspLI GGNNCC 2 cut(s) 937, 1105
BspMAI CTGCAG 1 cut(s) 1051
BspPI GGATC 1 cut(s) 699
BsrI ACTGG 1 cut(s) 485
BssECI CCNNGG 1 cut(s) 901
BssMI GATC 3 cut(s) 148, 691, 1006
Bst2UI CCWGG 1 cut(s) 902
Bst4CI ACNGT 5 cut(s) 86, 192, 327, 634, 858
Bst6I CTCTTC 2 cut(s) 775, 980
BstBAI YACGTR 2 cut(s) 97, 197
BstC8I GCNNGC 3 cut(s) 414, 881, 1068
BstDEI CTNAG 3 cut(s) 174, 510, 924
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 3 cut(s) 151, 694, 1009
BstMBI GATC 3 cut(s) 148, 691, 1006
BstMWI GCNNNNNNNGC 2 cut(s) 64, 885
BstNI CCWGG 1 cut(s) 902
BstNSI RCATGY 1 cut(s) 209
BstSCI CCNGG 1 cut(s) 900
BstSFI CTRYAG 2 cut(s) 624, 1047
BstSLI GKGCMC 1 cut(s) 96
BstV1I GCAGC 3 cut(s) 211, 863, 1033
BstV2I GAAGAC 1 cut(s) 534
BsuRI GGCC 1 cut(s) 1106
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 3 cut(s) 414, 881, 1068
CciI TCATGA 1 cut(s) 636
Cfr13I GGNCC 2 cut(s) 916, 1104
CviAII CATG 7 cut(s) 89, 179, 206, 429, 637, 844, 920
DdeI CTNAG 3 cut(s) 174, 510, 924
DpnI GATC 3 cut(s) 150, 693, 1008
DpnII GATC 3 cut(s) 148, 691, 1006
Eam1104I CTCTTC 2 cut(s) 775, 980
EarI CTCTTC 2 cut(s) 775, 980
Eco47I GGWCC 1 cut(s) 916
Eco57I CTGAAG 2 cut(s) 585, 1004
EcoO109I RGGNCCY 1 cut(s) 1104
EcoRI GAATTC 1 cut(s) 316
EcoRII CCWGG 1 cut(s) 900
EcoT22I ATGCAT 2 cut(s) 448, 809
FaeI CATG 7 cut(s) 92, 182, 209, 432, 640, 847, 923
FaqI GGGAC 1 cut(s) 1066
FatI CATG 7 cut(s) 88, 178, 205, 428, 636, 843, 919
FauI CCCGC 1 cut(s) 270
FbaI TGATCA 2 cut(s) 148, 1006
FblI GTMKAC 1 cut(s) 395
Fnu4HI GCNGC 3 cut(s) 225, 877, 1047
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 3 cut(s) 225, 877, 1047
FspBI CTAG 5 cut(s) 62, 159, 255, 515, 930
GluI GCNGC 3 cut(s) 225, 877, 1047
GsuI CTGGAG 2 cut(s) 502, 579
HaeIII GGCC 1 cut(s) 1106
Hin1II CATG 7 cut(s) 92, 182, 209, 432, 640, 847, 923
HincII GTYRAC 1 cut(s) 396
HindII GTYRAC 1 cut(s) 396
HinfI GANTC 7 cut(s) 32, 358, 486, 518, 906, 947, 1038
HphI GGTGA 3 cut(s) 293, 1040, 1102
Hpy166II GTNNAC 3 cut(s) 94, 166, 396
Hpy188I TCNGA 9 cut(s) 363, 547, 604, 781, 836, 911, 927, 1078, 1112
Hpy188III TCNNGA 7 cut(s) 17, 36, 321, 560, 637, 700, 1010
Hpy8I GTNNAC 3 cut(s) 94, 166, 396
HpyAV CCTTC 2 cut(s) 1025, 1054
HpyCH4III ACNGT 5 cut(s) 86, 192, 327, 634, 858
HpyCH4IV ACGT 3 cut(s) 96, 105, 196
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 885
HpyF3I CTNAG 3 cut(s) 174, 510, 924
HpySE526I ACGT 3 cut(s) 96, 105, 196
Hsp92II CATG 7 cut(s) 92, 182, 209, 432, 640, 847, 923
Ksp22I TGATCA 2 cut(s) 148, 1006
Kzo9I GATC 3 cut(s) 148, 691, 1006
LmnI GCTCC 3 cut(s) 790, 935, 1063
Lsp1109I GCAGC 3 cut(s) 211, 863, 1033
LweI GCATC 5 cut(s) 380, 455, 772, 897, 1075
MaeI CTAG 5 cut(s) 62, 159, 255, 515, 930
MaeII ACGT 3 cut(s) 96, 105, 196
MaeIII GTNAC 6 cut(s) 41, 106, 192, 349, 491, 764
MalI GATC 3 cut(s) 150, 693, 1008
MboI GATC 3 cut(s) 148, 691, 1006
MboII GAAGA 9 cut(s) 194, 315, 534, 620, 712, 762, 997, 1091, 1094
MhlI GDGCHC 1 cut(s) 96
MluCI AATT 7 cut(s) 99, 316, 588, 791, 867, 951, 974
MlyI GAGTC 4 cut(s) 26, 367, 956, 1032
Mph1103I ATGCAT 2 cut(s) 448, 809
MseI TTAA 3 cut(s) 248, 678, 954
MspR9I CCNGG 1 cut(s) 902
MvaI CCWGG 1 cut(s) 902
MwoI GCNNNNNNNGC 2 cut(s) 64, 885
NdeII GATC 3 cut(s) 148, 691, 1006
NlaIII CATG 7 cut(s) 92, 182, 209, 432, 640, 847, 923
NlaIV GGNNCC 2 cut(s) 937, 1105
NmuCI GTSAC 4 cut(s) 41, 192, 349, 764
NsiI ATGCAT 2 cut(s) 448, 809
NspI RCATGY 1 cut(s) 209
PagI TCATGA 1 cut(s) 636
PcsI WCGNNNNNNNCGW 1 cut(s) 102
PfeI GAWTC 3 cut(s) 486, 518, 906
PkrI GCNGC 3 cut(s) 226, 878, 1048
PleI GAGTC 4 cut(s) 26, 366, 955, 1032
PpsI GAGTC 4 cut(s) 26, 366, 955, 1032
Ppu21I YACGTR 2 cut(s) 97, 197
PshBI ATTAAT 1 cut(s) 954
Psp6I CCWGG 1 cut(s) 900
PspGI CCWGG 1 cut(s) 900
PspN4I GGNNCC 2 cut(s) 937, 1105
PspPI GGNCC 2 cut(s) 916, 1104
PstI CTGCAG 1 cut(s) 1051
SalI GTCGAC 1 cut(s) 394
SaqAI TTAA 3 cut(s) 248, 678, 954
SatI GCNGC 3 cut(s) 225, 877, 1047
Sau3AI GATC 3 cut(s) 148, 691, 1006
Sau96I GGNCC 2 cut(s) 916, 1104
SchI GAGTC 4 cut(s) 26, 367, 956, 1032
ScrFI CCNGG 1 cut(s) 902
SduI GDGCHC 1 cut(s) 96
SfaNI GCATC 5 cut(s) 380, 455, 772, 897, 1075
SfcI CTRYAG 2 cut(s) 624, 1047
SinI GGWCC 1 cut(s) 916
SmlI CTYRAG 2 cut(s) 648, 664
SmoI CTYRAG 2 cut(s) 648, 664
Sse9I AATT 7 cut(s) 99, 316, 588, 791, 867, 951, 974
SsiI CCGC 4 cut(s) 277, 410, 496, 1088
SspMI CTAG 5 cut(s) 62, 159, 255, 515, 930
StyD4I CCNGG 1 cut(s) 900
TaaI ACNGT 5 cut(s) 86, 192, 327, 634, 858
TaiI ACGT 3 cut(s) 99, 108, 199
TaqI TCGA 2 cut(s) 37, 395
TasI AATT 7 cut(s) 99, 316, 588, 791, 867, 951, 974
TfiI GAWTC 3 cut(s) 486, 518, 906
Tru1I TTAA 3 cut(s) 248, 678, 954
Tru9I TTAA 3 cut(s) 248, 678, 954
TseFI GTSAC 4 cut(s) 41, 192, 349, 764
TseI GCWGC 3 cut(s) 224, 876, 1046
Tsp45I GTSAC 4 cut(s) 41, 192, 349, 764
TspDTI ATGAA 6 cut(s) 126, 195, 252, 417, 841, 1013
TspGWI ACGGA 1 cut(s) 479
VneI GTGCAC 1 cut(s) 92
VpaK11BI GGWCC 1 cut(s) 916
VspI ATTAAT 1 cut(s) 954
XapI RAATTY 2 cut(s) 316, 974
XceI RCATGY 1 cut(s) 209
XmiI GTMKAC 1 cut(s) 395
XspI CTAG 5 cut(s) 62, 159, 255, 515, 930
Zsp2I ATGCAT 2 cut(s) 448, 809
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.