Rmu_ssc0000412.1_g000012

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000412.1
Physical Location & Seq
Forward (+)
82346 .. 98355
16010 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000412.1_g000012.1.cds

Sequence Viewer

Length: 6366 bp
atgcgagtttcacatttttgggggaaaaatgtggagttattaaagagaacctttgagctgaaaaatggcaagatacaatgtgttaaagaacctttttctcaaagcaaggctctggtgaggtctttatctcctctgtgggaggaggggttacttttagttaggtgctctgtatttgttgccgtgatatctggggtatgcttgttggtatggtatgggcagaaaaaagccaagggtcttattgaagccagggttttgccttctgtttgctcagtactcagtgagtatattcagcgcgaaattgtttttggtaaggttcgaaggatatcacctctgagcatcacattggaggcgagttcagttggccctcataatgaggaattttcttgtggtgaggtcccatctatgaaacttctttttcgtccttttgcaagtctgaggaggggaaggattgtgattgatgcagttttatcccatccaactgtcttgattgcgcagaagaaggattatacatggttagggataccctcatccgaaggtagtctgcagaggcacttatcaacagaagaaggaattgatcatcgtacaaaaacccggaggctagctagagaggaagcagctgatcgctgggaaagagcaagggatgaagcagctagaaaagctgcagagatgggttacattatttcagacaagggttccactccatccaaaggtgatgattcaaaggaaggtgatagccattcaggggatttaacaacctctgaatcgtttttatgcatggatgaaaagatgcactggagagatcactgcatggacacaggtgtcgattatgatatcaaacatgcagacttggagaaatcattgggtgttaaaataccgggttctgggcttaaattttggtccagagtgataaagggacctaaaaagcacaaattcaaaaggaagggcattgggaatgatatttctgcatctggttttactgccaaaagaagaattcttggggatagtgcagtaagggcacttgcatattttcaggatttggtgcatgggaagtctgatgaactttcacaggcatccggaagttatgatgtgatgaaccttgacacctatttgatgaagaatgaggttgctaataatgccaacactagtgtcgcaggtattggtcgagaaactgtcagagatgaaaaccggaatggaaaaggttctagagattcagcagaccacgcccttaaagaaaatcagaatgcaaacagtcattttagtagttttaatcccatacatgatccattggataggtccaatgtagatgagaaatccagttacccatccactggaaatgtttcagaaactaataccagttgtaatgtaaaagatgaggattttggacatgatgttaaaaataatcattctgaggatggtgaatcagaaaggcaagcaggtgaaacattgcagaattcaacttccacgatacccccttttgcaacatatgatcatgttcccacctggcccataagtcagaaattagggattccctctttttctagaaatgctggagttccaatatcccatcttctctctggtctcattcaaaagctgacatctagcatgcgccccagagttgaagatattgttgcagaacttgtcgacgaggtcaatgttgtgcagcctgaaggcattgagaagatgcttccagttacactggattctgtacaattcaaaggaggaacactcatgctacttgcatatggtgacagggaacctcgagagatggagaatgtcaatggacatgtgaagtttcaaaatcactatggtcgtgtgcatgtgcaagtcaatggcaactgtaagatgtggaggtctgacatcatgtctgaagatggtggctggttatctgcagatgtatttgttgacattgttgaacagaaatggcatgcgaacctaaaagttgctaacctttttgcgccgctttttgaacggattttagaaattccattaatatggtccaaaggaagagccactggtgaggttcacttgtgcatgtcaagaggagaatcatttcccaatcttcatggacagcttgatgtgacagggttggcttttcaaacaattgatgctccatcatcattttctgacatcgcggcaagcttatgtttccgtggccagcgaatattcttacacaatgcaagtggctggtttggtgatgttcctttggaagcgtctggagattttggtattcatcccgaggaaggagagtttcatcttatgtgtcaggtttcttgcgtggaagtaaatgccttgatgaaaactttcaagatgaagcctcttatgtttccgctggctggttcagtgactgcagtgtttaactgtcaaggtccattggatgctcctatatttgtgggaagtggaatggtatctagaaggatgtcccagtcagtttctgattttcctccatctgccgcatcagaagcagttttgaaaagtaaggaagctggtgctgtggcagcgtttgatcgtgtaccattttcatgcgtgtctgccaatttcactttcaacactgatagctgtgtcgctgacttgtatggaattagagctagtcttgtcgatggcggtgaaattcgaggggctgggaatgcatggatttgcccagagggtgaagttgatgatacatcaatggatgtgaatttctctggaagtatgtgctttgataaaattctgcatcgatatattcctggttatcttcaactgatgccactgaaattaggggatttaaatggagaaacaaaactttctggatccctactgagaccgaggtttgacattaaatggacggctccaaaggctgaagggtccttcagcgatgctcgaggagatatcataatagcgcatgattccattactattaattcctcatctactgcctttgacttgtcctcaaatgttctaacatcttataaggataaagattggctaaacaaaagagatgctgagacaaagagtgccatgccatttgttgttgagggaatcgacttggatttacgtatgcgtggttttgagtttttcagcttggtatcatcttatccctttgattctccgaaacccatgcatttgaaagcaacagggaagatcaagtttcagggaaaggttttaaagccttttagtatttctaatggacaagaatttggttcggagagaaataagcaacaggtgaatatgacagatacaggaaagacagatagtctcgtaggagaggtttcaatttcgggtctcaaattgaatcagttgatgttggcccctcagttggctggatcgttgagcatttcacgtgagtgtatcaagttagatgccacaggtaggccagatgaaagtcttgtagtggagtttgtagggccactgaagcctaacagtgacactaacacacaaagtggacaattgttgtctttcttccttcaaaagggccaactaaaagcaaacatttgcttccaaccatttcattctgctagcttggagatacgtcagttaccactcgatgagttggaattagcttcgctccgtggaacaatacaaaaggcagaaattcagcttaatcttcagaaacgaagaggtcatgggctgctatctgtacttcggccaaagtttagcggtgtactaggtgaagcccttgatgtggctgctagatggagtggggatgttatcactgttgagaaaaccgtcttggagcaaagcaatagtcgttatgagcttcagggtgaatatgtattgcctggcagtcgagatcgcaaccctgctgagaaggaaaggggaggtttattgaaaagagcgatggctgggaatctgggtagtgtcatatcttctatgggaaggtggagaatgagactggaagttcctagagctgaggttgctgagatgcttccccttgccagacttgtttctcgaagtacagatcccgctgttcactcaagatcaaaggacctgtttgttcaaagcttgcagtcggttggattatatacagaaagtctcaaagaactgcttgaggttatacggggacattataccccattaaatgaagttattctggaagatgatcttccaggtttaactgagctcagaggtagctggcatggctctcttgatgcaagcggaggtggcaatggggacacaatggcagaatttgattttcatggggatgactgggagtggggaacctacaaaactcagcgcgttctggcagtaggtgcatacagcaatgatgatggtttgcgcctggaaaagatctttattcagaaagacaacgccacagtccatgcagatgggactttgttagggccgaaaacaaatctacactttgctgttttgaactttcctgttagtctagttcccactgtgattcaggtcattgaatcttctgctactgatgctgttcaatctctacggcaatttttagcaccaattagaggcatactgcacatggaaggcgatcttagagggagtcttgcgaaaccagaatgtgatgtgcaagtaaggctcctggatggtgccgttggggggattgatcttggacgagctgaaattgttgcttccctcacctcaaccagtcgttttctgttcaatgcaaaatttgaaccaatcatccaaactgggcatgtacacattcagggaagcatacctgttacttttgttcagaataacatgttagaggaagaagatttagaaaaagataaaagccgagctacttcctgggaccatggttgggtgaaggaaagaggcagggggtctagcgatgatgccagtgaaaagaaacttccaagagagaggaatgaagaaggctgggatacgggattagctgaaagccttaaaggtttaaactggaacatattagatgtaggggaagtcagaatagatgctgatataaaagatgggggcatgatgatgttaactgctttatctccttatgctaaatggcttcagggcaatgccgacatcatgcttcaggtcagaggcacagttgaacaaccagtgctggatggatatgcatccttccacagggcatctatatcatcaccggttctctggaaaccacttacaaatttcggtggcacagttcatgtgaaatcaaataggttatgcatcacttcattggagagtagagtaagtagaaggggtaagctgttcgtcaagggaaacctgccccttagaacaagtgaagcatcccttggagataaaattgacttgaaatgtgaagttctggaagtgcgggcaaaaaatattttaagtgcccaggttgacactcagatgcagataactggttccatattgcaaccaaacatctctggaagtattaaattgagccatggtgaagcatatttgccacacgataagggtagtggggctgcccccaatagattggcaacaaatgaacctaggcttcctagtacaggtgttgatcgagcagttgcctcgagatatgtttcacggtttttcagttcacaacctgctgcttcatggacaaaattccctcaaccttcagcggttaagcaagcagtacaggagatggagcaagtgaacattaaaccgaatgtagatattcaacttagtgatttgaagcttgttctaggaccagagctgaggattgtatatcctttaattctaaattttgctgttagtggagagctagagttaaatggtccagctcatcccaaatcgataaaacctagaggcatcttaacttttgaaaatggtgatgtcaatctcgtcgctactcaggtgaggctcaggcaagagcatctgaatattgcaaagtttgagcctgaacatggattagatccaatgctagatctagttttagtggggtctgagtggcaattcaggattcaaagtcgagccagcaactggcaggaaaaactggttgtgacctccacccgttctgtggaacaggacgctctctcacctactgaggctgctagagtctttgaaagtcaattggcagagtccatcttggaaggtgatgggcagcttgcatttcaaaagcttgcaactacaacacttgaaaaactaatgccgaggatagaagggaagggagagtttggtcaggcaaggtggaggctagtgtatgcaccacagatccctagcttgctttctgttgatcctactgtggatcctctgaaatctctggccagtaatatttcatttggtacagaagtcgaagtccaacttgggaaacgtcttcaggcctcaattgttcgacaaatgaaggactcggaaatggcaatgcaatggacattgatctaccagcttaccagccgcctgcgtgttctgctacagtctgctccttcaaaacgcctcatttttgaatattctgcaacatctcaggattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

2121

Amino Acids

234.0

Weight (kDa)

6.22

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2946
AarI CACCTGC 1 cut(s) 1424
AasI GACNNNNNNGTC 1 cut(s) 818
Acc16I TGCGCA 1 cut(s) 492
Acc36I ACCTGC 4 cut(s) 1142, 1424, 5184, 5491
AccB1I GGYRCC 1 cut(s) 4526
AccB7I CCANNNNNTGG 2 cut(s) 1328, 5880
AccI GTMKAC 1 cut(s) 1641
AccII CGCG 3 cut(s) 294, 2132, 4212
AccIII TCCGGA 1 cut(s) 1073
AcoI YGGCCR 3 cut(s) 2152, 3620, 6162
AcvI CACGTG 1 cut(s) 3317
AdeI CACNNNGTG 1 cut(s) 3416
AflIII ACRYGT 2 cut(s) 1783, 4680
AgeI ACCGGT 1 cut(s) 5053
AhdI GACNNNNNGTC 2 cut(s) 1861, 3228
AhlI ACTAGT 1 cut(s) 1142
AjnI CCWGG 9 cut(s) 245, 1499, 2722, 3754, 4081, 4254, 4518, 4727, 5268
AleI CACNNNNGTG 1 cut(s) 3319
AloI GAACNNNNNNTCC 2 cut(s) 4605, 4637
Alw21I GWGCWC 2 cut(s) 167, 4098
Alw26I GTCTC 7 cut(s) 1583, 2791, 2975, 3236, 3263, 3859, 4013
AlwNI CAGNNNCTG 3 cut(s) 2345, 2432, 5880
Ama87I CYCGRG 4 cut(s) 1758, 2234, 2856, 5449
Aor13HI TCCGGA 1 cut(s) 1073
ArsI GACNNNNNNTTYG 2 cut(s) 3706, 3738
AseI ATTAAT 2 cut(s) 1988, 2895
AsiGI ACCGGT 1 cut(s) 5053
Asp700I GAANNNNTTC 5 cut(s) 1198, 1336, 2049, 2300, 4062
AspA2I CCTAGG 1 cut(s) 5411
AspLEI GCGC 7 cut(s) 294, 493, 1608, 1957, 2878, 4212, 4254
AsuC2I CCSGG 2 cut(s) 592, 876
AsuII TTCGAA 1 cut(s) 316
AsuNHI GCTAGC 2 cut(s) 598, 3491
AvaI CYCGRG 4 cut(s) 1758, 2234, 2856, 5449
AvrII CCTAGG 1 cut(s) 5411
BaeGI GKGCMC 2 cut(s) 1018, 5269
BaeI ACNNNNGTAYC 4 cut(s) 3494, 3527, 6174, 6207
BalI TGGCCA 2 cut(s) 2154, 6164
BamHI GGATCC 2 cut(s) 2786, 6145
BanI GGYRCC 1 cut(s) 4526
BanII GRGCYC 1 cut(s) 4098
BbrPI CACGTG 1 cut(s) 3317
BbsI GAAGAC 1 cut(s) 6206
Bbv12I GWGCWC 2 cut(s) 167, 4098
BbvCI CCTCAGC 2 cut(s) 3885, 5615
BceAI ACGGC 4 cut(s) 164, 2838, 4439, 4514
BcgI CGANNNNNNTGC 4 cut(s) 3076, 3110, 5430, 5464
BciT130I CCWGG 9 cut(s) 247, 1501, 2724, 3756, 4083, 4256, 4520, 4729, 5270
BciVI GTATCC 2 cut(s) 513, 4816
BclI TGATCA 2 cut(s) 574, 1486
BcnI CCSGG 2 cut(s) 592, 876
BcoDI GTCTC 7 cut(s) 1583, 2791, 2975, 3236, 3263, 3859, 4013
BcuI ACTAGT 1 cut(s) 1142
BfmI CTRYAG 5 cut(s) 542, 660, 1887, 2346, 6308
BfuAI ACCTGC 4 cut(s) 1142, 1424, 5184, 5491
BfuI GTATCC 2 cut(s) 513, 4816
BglII AGATCT 2 cut(s) 4263, 5824
BlnI CCTAGG 1 cut(s) 5411
BmcAI AGTACT 1 cut(s) 273
BmeRI GACNNNNNGTC 2 cut(s) 1861, 3228
BmeT110I CYCGRG 4 cut(s) 1758, 2234, 2856, 5449
BmrI ACTGGG 3 cut(s) 2416, 4192, 4638
BmtI GCTAGC 2 cut(s) 602, 3495
BmuI ACTGGG 3 cut(s) 2416, 4192, 4638
BpiI GAAGAC 1 cut(s) 6206
BplI GAGNNNNNCTC 2 cut(s) 1710, 1742
BpmI CTGGAG 3 cut(s) 814, 1569, 2235
Bpu10I CCTNAGC 3 cut(s) 3885, 5615, 5762
Bpu14I TTCGAA 1 cut(s) 316
BpuEI CTTGAG 2 cut(s) 3934, 4043
BpuMI CCSGG 2 cut(s) 592, 876
Bsa29I ATCGAT 2 cut(s) 2713, 5693
BsaAI YACGTR 2 cut(s) 3032, 3317
BsaBI GATNNNNATC 2 cut(s) 5023, 5736
BsaI GGTCTC 3 cut(s) 1583, 2791, 3263
BsaWI WCCGGW 3 cut(s) 1073, 1185, 5053
BsaXI ACNNNNNCTCC 2 cut(s) 131, 161
Bse118I RCCGGY 1 cut(s) 5053
Bse3DI GCAATG 6 cut(s) 1442, 4147, 4243, 4969, 6264, 6269
Bse8I GATNNNNATC 2 cut(s) 5023, 5736
BseAI TCCGGA 1 cut(s) 1073
BseBI CCWGG 9 cut(s) 247, 1501, 2724, 3756, 4083, 4256, 4520, 4729, 5270
BseCI ATCGAT 2 cut(s) 2713, 5693
BseJI GATNNNNATC 2 cut(s) 5023, 5736
BseMI GCAATG 6 cut(s) 1442, 4147, 4243, 4969, 6264, 6269
BseRI GAGGAG 5 cut(s) 120, 155, 451, 2055, 2874
BseSI GKGCMC 2 cut(s) 1018, 5269
BseYI CCCAGC 4 cut(s) 624, 2618, 3818, 4818
BsgI GTGCAG 3 cut(s) 1026, 1679, 4439
Bsh1236I CGCG 3 cut(s) 294, 2132, 4212
BshNI GGYRCC 1 cut(s) 4526
BshTI ACCGGT 1 cut(s) 5053
BshVI ATCGAT 2 cut(s) 2713, 5693
BsiHKAI GWGCWC 2 cut(s) 167, 4098
BsiHKCI CYCGRG 4 cut(s) 1758, 2234, 2856, 5449
BsiSI CCGG 5 cut(s) 592, 875, 1074, 1186, 5054
BslFI GGGAC 7 cut(s) 380, 927, 2404, 4050, 4160, 4318, 4745
BsmAI GTCTC 7 cut(s) 1583, 2791, 2975, 3236, 3263, 3859, 4013
BsmFI GGGAC 7 cut(s) 380, 927, 2404, 4050, 4160, 4318, 4745
BsmI GAATGC 2 cut(s) 1246, 2629
Bso31I GGTCTC 3 cut(s) 1583, 2791, 3263
BsoBI CYCGRG 4 cut(s) 1758, 2234, 2856, 5449
Bsp119I TTCGAA 1 cut(s) 316
Bsp1286I GDGCHC 4 cut(s) 167, 1018, 4098, 5269
Bsp13I TCCGGA 1 cut(s) 1073
Bsp1407I TGTACA 2 cut(s) 1705, 4636
Bsp19I CCATGG 2 cut(s) 4735, 5341
BspDI ATCGAT 2 cut(s) 2713, 5693
BspEI TCCGGA 1 cut(s) 1073
BspFNI CGCG 3 cut(s) 294, 2132, 4212
BspMAI CTGCAG 4 cut(s) 546, 664, 1891, 2350
BspMI ACCTGC 4 cut(s) 1142, 1424, 5184, 5491
BspOI GCTAGC 2 cut(s) 602, 3495
BspQI GCTCTTC 1 cut(s) 1999
BspT104I TTCGAA 1 cut(s) 316
BspT107I GGYRCC 1 cut(s) 4526
BspTNI GGTCTC 3 cut(s) 1583, 2791, 3263
BsrDI GCAATG 6 cut(s) 1442, 4147, 4243, 4969, 6264, 6269
BsrFI RCCGGY 1 cut(s) 5053
BsrGI TGTACA 2 cut(s) 1705, 4636
BssAI RCCGGY 1 cut(s) 5053
BssT1I CCWWGG 5 cut(s) 228, 4735, 5203, 5341, 5411
Bst2UI CCWGG 9 cut(s) 247, 1501, 2724, 3756, 4083, 4256, 4520, 4729, 5270
Bst6I CTCTTC 2 cut(s) 1999, 3586
BstAPI GCANNNNNTGC 1 cut(s) 4226
BstAUI TGTACA 2 cut(s) 1705, 4636
BstBAI YACGTR 2 cut(s) 3032, 3317
BstBI TTCGAA 1 cut(s) 316
BstDSI CCRYGG 4 cut(s) 2149, 3544, 4735, 5341
BstENI CCTNNNNNAGG 3 cut(s) 3443, 5032, 5424
BstFNI CGCG 3 cut(s) 294, 2132, 4212
BstHHI GCGC 7 cut(s) 294, 493, 1608, 1957, 2878, 4212, 4254
BstMAI GTCTC 7 cut(s) 1583, 2791, 2975, 3236, 3263, 3859, 4013
BstNI CCWGG 9 cut(s) 247, 1501, 2724, 3756, 4083, 4256, 4520, 4729, 5270
BstNSI RCATGY 8 cut(s) 842, 1606, 1787, 1820, 1928, 2035, 4637, 4684
BstSFI CTRYAG 5 cut(s) 542, 660, 1887, 2346, 6308
BstSLI GKGCMC 2 cut(s) 1018, 5269
BstSNI TACGTA 1 cut(s) 3032
BstUI CGCG 3 cut(s) 294, 2132, 4212
BstV2I GAAGAC 1 cut(s) 6206
BstX2I RGATCY 7 cut(s) 2786, 3934, 4263, 5812, 5824, 6111, 6145
BstXI CCANNNNNNTGG 3 cut(s) 1992, 4301, 5395
BstYI RGATCY 7 cut(s) 2786, 3934, 4263, 5812, 5824, 6111, 6145
Bsu15I ATCGAT 2 cut(s) 2713, 5693
BsuI GTATCC 2 cut(s) 513, 4816
BsuTUI ATCGAT 2 cut(s) 2713, 5693
BtgI CCRYGG 4 cut(s) 2149, 3544, 4735, 5341
BtgZI GCGATG 4 cut(s) 2113, 2865, 3827, 4785
BtsI GCAGTG 2 cut(s) 802, 2355
BveI ACCTGC 4 cut(s) 1142, 1424, 5184, 5491
CaiI CAGNNNCTG 3 cut(s) 2345, 2432, 5880
CfoI GCGC 7 cut(s) 294, 493, 1608, 1957, 2878, 4212, 4254
Cfr10I RCCGGY 1 cut(s) 5053
ClaI ATCGAT 2 cut(s) 2713, 5693
CseI GACGC 2 cut(s) 2199, 5936
CspAI ACCGGT 1 cut(s) 5053
CspCI CAANNNNNGTGG 2 cut(s) 2161, 2196
DraI TTTAAA 3 cut(s) 2763, 3141, 4854
DraIII CACNNNGTG 1 cut(s) 3416
DrdI GACNNNNNNGTC 1 cut(s) 818
DriI GACNNNNNGTC 2 cut(s) 1861, 3228
DseDI GACNNNNNNGTC 1 cut(s) 818
EaeI YGGCCR 3 cut(s) 2152, 3620, 6162
Eam1104I CTCTTC 2 cut(s) 1999, 3586
Eam1105I GACNNNNNGTC 2 cut(s) 1861, 3228
EarI CTCTTC 2 cut(s) 1999, 3586
Ecl136II GAGCTC 1 cut(s) 4096
Eco105I TACGTA 1 cut(s) 3032
Eco130I CCWWGG 5 cut(s) 228, 4735, 5203, 5341, 5411
Eco147I AGGCCT 1 cut(s) 6221
Eco24I GRGCYC 1 cut(s) 4098
Eco31I GGTCTC 3 cut(s) 1583, 2791, 3263
Eco32I GATATC 4 cut(s) 186, 324, 832, 2866
Eco53kI GAGCTC 1 cut(s) 4096
Eco72I CACGTG 1 cut(s) 3317
Eco88I CYCGRG 4 cut(s) 1758, 2234, 2856, 5449
EcoICRI GAGCTC 1 cut(s) 4096
EcoNI CCTNNNNNAGG 3 cut(s) 3443, 5032, 5424
EcoO109I RGGNCCY 4 cut(s) 394, 914, 2841, 3961
EcoRI GAATTC 2 cut(s) 990, 1450
EcoRII CCWGG 9 cut(s) 245, 1499, 2722, 3754, 4081, 4254, 4518, 4727, 5268
EcoRV GATATC 4 cut(s) 186, 324, 832, 2866
EcoT14I CCWWGG 5 cut(s) 228, 4735, 5203, 5341, 5411
EcoT22I ATGCAT 5 cut(s) 776, 2629, 3099, 5026, 5120
EcoT38I GRGCYC 1 cut(s) 4098
ErhI CCWWGG 5 cut(s) 228, 4735, 5203, 5341, 5411
FaqI GGGAC 7 cut(s) 380, 927, 2404, 4050, 4160, 4318, 4745
FauI CCCGC 2 cut(s) 3946, 5238
FauNDI CATATG 2 cut(s) 1483, 1741
FbaI TGATCA 2 cut(s) 574, 1486
FblI GTMKAC 1 cut(s) 1641
FriOI GRGCYC 1 cut(s) 4098
FspI TGCGCA 1 cut(s) 492
GlaI GCGC 7 cut(s) 293, 492, 1607, 1956, 2877, 4211, 4253
GsaI CCCAGC 4 cut(s) 628, 2622, 3822, 4822
GsuI CTGGAG 3 cut(s) 814, 1569, 2235
HapII CCGG 5 cut(s) 592, 875, 1074, 1186, 5054
HgaI GACGC 2 cut(s) 2199, 5936
HhaI GCGC 7 cut(s) 294, 493, 1608, 1957, 2878, 4212, 4254
Hin6I GCGC 7 cut(s) 292, 491, 1606, 1955, 2876, 4210, 4252
HinP1I GCGC 7 cut(s) 292, 491, 1606, 1955, 2876, 4210, 4252
HincII GTYRAC 4 cut(s) 1642, 1903, 4926, 5275
HindII GTYRAC 4 cut(s) 1642, 1903, 4926, 5275
HindIII AAGCTT 4 cut(s) 2137, 3976, 5594, 6017
HpaI GTTAAC 1 cut(s) 4926
HpaII CCGG 5 cut(s) 592, 875, 1074, 1186, 5054
Hpy99I CGWCG 2 cut(s) 1646, 5747
HpyCH4IV ACGT 4 cut(s) 3031, 3316, 3505, 6211
HpySE526I ACGT 4 cut(s) 3031, 3316, 3505, 6211
HspAI GCGC 7 cut(s) 292, 491, 1606, 1955, 2876, 4210, 4252
Kpn2I TCCGGA 1 cut(s) 1073
Ksp22I TGATCA 2 cut(s) 574, 1486
KspAI GTTAAC 1 cut(s) 4926
LguI GCTCTTC 1 cut(s) 1999
LmnI GCTCC 8 cut(s) 2113, 2383, 2830, 3546, 3709, 4521, 5545, 6322
MaeII ACGT 4 cut(s) 3031, 3316, 3505, 6211
MfeI CAATTG 4 cut(s) 2100, 3422, 5969, 6225
MflI RGATCY 7 cut(s) 2786, 3934, 4263, 5812, 5824, 6111, 6145
MhlI GDGCHC 4 cut(s) 167, 1018, 4098, 5269
MlsI TGGCCA 2 cut(s) 2154, 6164
MluNI TGGCCA 2 cut(s) 2154, 6164
MlyI GAGTC 4 cut(s) 4489, 5964, 5987, 6239
MmeI TCCRAC 5 cut(s) 500, 3499, 3507, 3970, 6223
Mox20I TGGCCA 2 cut(s) 2154, 6164
Mph1103I ATGCAT 5 cut(s) 776, 2629, 3099, 5026, 5120
MroI TCCGGA 1 cut(s) 1073
MroXI GAANNNNTTC 5 cut(s) 1198, 1336, 2049, 2300, 4062
MscI TGGCCA 2 cut(s) 2154, 6164
MslI CAYNNNNRTG 7 cut(s) 1990, 2518, 3319, 4176, 4299, 4919, 5282
Msp20I TGGCCA 2 cut(s) 2154, 6164
MspA1I CMGCKG 4 cut(s) 617, 2329, 3941, 5519
MspI CCGG 5 cut(s) 592, 875, 1074, 1186, 5054
MssI GTTTAAAC 1 cut(s) 4854
MunI CAATTG 4 cut(s) 2100, 3422, 5969, 6225
Mva1269I GAATGC 2 cut(s) 1246, 2629
MvaI CCWGG 9 cut(s) 247, 1501, 2724, 3756, 4083, 4256, 4520, 4729, 5270
MvnI CGCG 3 cut(s) 294, 2132, 4212
NciI CCSGG 2 cut(s) 592, 876
NcoI CCATGG 2 cut(s) 4735, 5341
NdeI CATATG 2 cut(s) 1483, 1741
NheI GCTAGC 2 cut(s) 598, 3491
NmeAIII GCCGAG 2 cut(s) 4742, 6075
NmuCI GTSAC 5 cut(s) 1745, 2077, 2341, 3398, 5899
NsbI TGCGCA 1 cut(s) 492
NsiI ATGCAT 5 cut(s) 776, 2629, 3099, 5026, 5120
NspI RCATGY 8 cut(s) 842, 1606, 1787, 1820, 1928, 2035, 4637, 4684
NspV TTCGAA 1 cut(s) 316
OliI CACNNNNGTG 1 cut(s) 3319
PaeI GCATGC 2 cut(s) 1606, 1928
PaeR7I CTCGAG 3 cut(s) 1758, 2856, 5449
PaqCI CACCTGC 1 cut(s) 1424
PceI AGGCCT 1 cut(s) 6221
PciI ACATGT 2 cut(s) 1783, 4680
PciSI GCTCTTC 1 cut(s) 1999
PctI GAATGC 2 cut(s) 1246, 2629
PdmI GAANNNNTTC 5 cut(s) 1198, 1336, 2049, 2300, 4062
PflFI GACNNNGTC 1 cut(s) 1646
PflMI CCANNNNNTGG 2 cut(s) 1328, 5880
PfoI TCCNGGA 1 cut(s) 4518
PinAI ACCGGT 1 cut(s) 5053
PleI GAGTC 4 cut(s) 4488, 5963, 5986, 6239
PmaCI CACGTG 1 cut(s) 3317
PmeI GTTTAAAC 1 cut(s) 4854
PmlI CACGTG 1 cut(s) 3317
PpsI GAGTC 4 cut(s) 4488, 5963, 5986, 6239
Ppu21I YACGTR 2 cut(s) 3032, 3317
PpuMI RGGWCCY 4 cut(s) 394, 914, 2841, 3961
PscI ACATGT 2 cut(s) 1783, 4680
PshBI ATTAAT 2 cut(s) 1988, 2895
PsiI TTATAA 1 cut(s) 2946
Psp124BI GAGCTC 1 cut(s) 4098
Psp5II RGGWCCY 4 cut(s) 394, 914, 2841, 3961
Psp6I CCWGG 9 cut(s) 245, 1499, 2722, 3754, 4081, 4254, 4518, 4727, 5268
PspCI CACGTG 1 cut(s) 3317
PspFI CCCAGC 4 cut(s) 624, 2618, 3818, 4818
PspGI CCWGG 9 cut(s) 245, 1499, 2722, 3754, 4081, 4254, 4518, 4727, 5268
PspPPI RGGWCCY 4 cut(s) 394, 914, 2841, 3961
PspXI VCTCGAGB 1 cut(s) 2856
PstI CTGCAG 4 cut(s) 546, 664, 1891, 2350
PstNI CAGNNNCTG 3 cut(s) 2345, 2432, 5880
PsuI RGATCY 7 cut(s) 2786, 3934, 4263, 5812, 5824, 6111, 6145
PsyI GACNNNGTC 1 cut(s) 1646
PvuII CAGCTG 1 cut(s) 617
RseI CAYNNNNRTG 7 cut(s) 1990, 2518, 3319, 4176, 4299, 4919, 5282
SacI GAGCTC 1 cut(s) 4098
SalI GTCGAC 1 cut(s) 1640
SapI GCTCTTC 1 cut(s) 1999
ScaI AGTACT 1 cut(s) 273
SchI GAGTC 4 cut(s) 4489, 5964, 5987, 6239
SduI GDGCHC 4 cut(s) 167, 1018, 4098, 5269
SfcI CTRYAG 5 cut(s) 542, 660, 1887, 2346, 6308
Sfr274I CTCGAG 3 cut(s) 1758, 2856, 5449
SfuI TTCGAA 1 cut(s) 316
SlaI CTCGAG 3 cut(s) 1758, 2856, 5449
SmiI ATTTAAAT 1 cut(s) 2763
SmiMI CAYNNNNRTG 7 cut(s) 1990, 2518, 3319, 4176, 4299, 4919, 5282
SmlI CTYRAG 5 cut(s) 1758, 2856, 3949, 4022, 5449
SmoI CTYRAG 5 cut(s) 1758, 2856, 3949, 4022, 5449
SnaBI TACGTA 1 cut(s) 3032
SpeI ACTAGT 1 cut(s) 1142
SphI GCATGC 2 cut(s) 1606, 1928
SseBI AGGCCT 1 cut(s) 6221
SspI AATATT 5 cut(s) 2163, 5257, 5782, 6172, 6344
SstI GAGCTC 1 cut(s) 4098
StuI AGGCCT 1 cut(s) 6221
StyI CCWWGG 5 cut(s) 228, 4735, 5203, 5341, 5411
SwaI ATTTAAAT 1 cut(s) 2763
TaiI ACGT 4 cut(s) 3034, 3319, 3508, 6214
TaqII GACCGA 1 cut(s) 2815
TatI WGTACW 8 cut(s) 271, 1705, 3613, 3637, 3929, 4636, 5423, 5533
TauI GCSGC 4 cut(s) 1960, 2135, 2453, 6294
TseFI GTSAC 5 cut(s) 1745, 2077, 2341, 3398, 5899
Tsp45I GTSAC 5 cut(s) 1745, 2077, 2341, 3398, 5899
TspGWI ACGGA 3 cut(s) 1984, 2138, 3533
Tth111I GACNNNGTC 1 cut(s) 1646
Van91I CCANNNNNTGG 2 cut(s) 1328, 5880
VspI ATTAAT 2 cut(s) 1988, 2895
XagI CCTNNNNNAGG 3 cut(s) 3443, 5032, 5424
XbaI TCTAGA 3 cut(s) 1202, 1538, 2408
XceI RCATGY 8 cut(s) 842, 1606, 1787, 1820, 1928, 2035, 4637, 4684
XcmI CCANNNNNNNNNTGG 2 cut(s) 1571, 5914
XhoI CTCGAG 3 cut(s) 1758, 2856, 5449
XmaJI CCTAGG 1 cut(s) 5411
XmiI GTMKAC 1 cut(s) 1641
XmnI GAANNNNTTC 5 cut(s) 1198, 1336, 2049, 2300, 4062
ZrmI AGTACT 1 cut(s) 273
Zsp2I ATGCAT 5 cut(s) 776, 2629, 3099, 5026, 5120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.