Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000465.1

Orthogroup ID

OG0010563

Physical Location & Seq

Genomic Coordinates Reverse (-)

93912 .. 98202

Gene Structure 4291 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000465.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1122 bp

atgctagagcctgagctgtgtgcttctagggtgctgtcaccttctcatgacgaaagtggggatgatgagctttcagttcttcccaggcacactaaggtaattgttactgggaacaacagaacaaagtctgtgttggtgggtctacagggagtggtcaagaaagcggttgggcttggtggttggcactggctggttctgaaaaatggcgttgaagtcaagctgcaaaggaacgcattgagtgtgctggaacatcctacagggaatgaggaagatttcgacaatgattatgataactctagcagtagctctgaactgggtgtgaaggagaatgatttcactaggagtcttcagttccacagacatgataaaccaagatttcggtatccaaaatcatatgttccatccaccaagtcgatttatcgtggcagttatcaagaatttcagtccatccacaaacctcagctgagagtaaacatggcaaaactaggaacaagcactttgcggaggtactgcaggcacttcaaccttgtgggcatggatgatcagagagtaaacatggcaaaactaggaacaagcactttgcggaggtactgcaggcacttcaaccttgtaagcagctatcctaatccaacgagggagcaactgattaacgttgtgcaacgacattttacgtcacagctgatgcgattggatgaggtatcagtgatcactgaatttgtcaatgctgcaaggaggcgcaaatctgccgagttggctaggaaacgtacagaacgagaaataaacaagtccaccttcctccttttccccgattccgattccgatttcgattccgatcgacgcctctccgccgtcaccaggtactcactctcgctaactctccatctcgagaaaaaccgccgcttaatttgtcccggtgacgattcattcccccgatttcgattccgatcgacgcctctcctccgtcaccaggtactcactctcgctaactctccatctcgagaaaaaccgccgcttaatttgtcccgtttcgttggaaattttaagaagctgggggtgttggaacgtggaaatcgtgtgttaggtttgaagcgcaaggggatatgtggtgccgagtacctatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SAP30_Sin3_bdg

Protein Analysis

373

Amino Acids

42.83

Weight (kDa)

10.0

Isoelectric Point (pI)

45.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010563)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g02810 FvH4_5g02810 FvH4_5g02810
malus_domestica	MD06G1087400.v1.1 MD14G1108300.v1.1
prunus_persica	Prupe.5G103700_v2.0.a1 Prupe.5G103700_v2.0.a1 Prupe.5G103700_v2.0.a1 Prupe.5G103700_v2.0.a1 Prupe.5G103700_v2.0.a1
pyrus_communis	pycom06g08350 pycom14g10300
rosa_chinensis	RchiOBHm_Chr7g0197141
rosa_laevigata	RLG00000003958
rosa_multiflora	Rmu_ssc0000465.1_g000023
rosa_roxburghii	Rroxscaffold_3G00258660
rosa_rugosa	Rorug07G0038100
rosa_samantha	Rh7AG162700 Rh7CG170700 Rh7DG164100
rosa_wichuraiana	Rw7G014200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	1106
AccI	GTMKAC	1 cut(s)	142
AciI	CCGC	8 cut(s)	164, 502, 583, 846, 895, 898, 1007, 1010
AclI	AACGTT	1 cut(s)	651
AcsI	RAATTY	3 cut(s)	437, 713, 1036
AcuI	CTGAAG	1 cut(s)	332
AcyI	GRCGYC	2 cut(s)	838, 950
AfaI	GTAC	6 cut(s)	509, 590, 766, 860, 972, 1115
AfiI	CCNNNNNNNGG	2 cut(s)	855, 967
AgsI	TTSAA	4 cut(s)	212, 523, 604, 1087
AjnI	CCWGG	3 cut(s)	83, 854, 966
AluBI	AGCT	8 cut(s)	16, 70, 220, 306, 463, 618, 679, 1048
AluI	AGCT	8 cut(s)	16, 70, 220, 306, 463, 618, 679, 1048
Ama87I	CYCGRG	2 cut(s)	884, 996
ApeKI	GCWGC	3 cut(s)	220, 615, 725
ApoI	RAATTY	3 cut(s)	437, 713, 1036
Asp700I	GAANNNNTTC	1 cut(s)	332
AspLEI	GCGC	2 cut(s)	738, 1092
AsuC2I	CCSGG	1 cut(s)	912
AsuHPI	GGTGA	4 cut(s)	30, 844, 926, 956
AvaI	CYCGRG	2 cut(s)	884, 996
BanI	GGYRCC	1 cut(s)	1106
BbsI	GAAGAC	1 cut(s)	338
BbvCI	CCTCAGC	1 cut(s)	459
BbvI	GCAGC	3 cut(s)	207, 627, 712
BccI	CCATC	4 cut(s)	409, 455, 888, 1000
BceAI	ACGGC	1 cut(s)	833
BciT130I	CCWGG	3 cut(s)	85, 856, 968
BciVI	GTATCC	1 cut(s)	393
BclI	TGATCA	2 cut(s)	541, 705
BcnI	CCSGG	1 cut(s)	912
BfaI	CTAG	7 cut(s)	5, 27, 297, 339, 485, 566, 756
BfmI	CTRYAG	5 cut(s)	143, 255, 511, 592, 1118
BfuI	GTATCC	1 cut(s)	393
BglI	GCCNNNNNGGC	1 cut(s)	752
BisI	GCNGC	5 cut(s)	221, 616, 726, 898, 1010
BlsI	GCNGC	5 cut(s)	222, 617, 727, 899, 1011
Bme1390I	CCNGG	4 cut(s)	85, 856, 912, 968
BmeT110I	CYCGRG	2 cut(s)	884, 996
BmiI	GGNNCC	1 cut(s)	1108
BmrFI	CCNGG	4 cut(s)	85, 856, 912, 968
BmrI	ACTGGG	2 cut(s)	117, 323
BmsI	GCATC	1 cut(s)	672
BmuI	ACTGGG	2 cut(s)	117, 323
BpiI	GAAGAC	1 cut(s)	338
Bpu10I	CCTNAGC	2 cut(s)	12, 459
BpuMI	CCSGG	1 cut(s)	912
BsaBI	GATNNNNATC	2 cut(s)	831, 943
BsaHI	GRCGYC	2 cut(s)	838, 950
BsaJI	CCNNGG	1 cut(s)	83
Bsc4I	CCNNNNNNNGG	2 cut(s)	855, 967
Bse1I	ACTGG	3 cut(s)	112, 191, 318
Bse8I	GATNNNNATC	2 cut(s)	831, 943
BseBI	CCWGG	3 cut(s)	85, 856, 968
BseDI	CCNNGG	1 cut(s)	83
BseGI	GGATG	6 cut(s)	67, 250, 401, 447, 544, 697
BseJI	GATNNNNATC	2 cut(s)	831, 943
BseLI	CCNNNNNNNGG	2 cut(s)	855, 967
BseMII	CTCAG	2 cut(s)	455, 473
BseNI	ACTGG	3 cut(s)	112, 191, 318
BseRI	GAGGAG	1 cut(s)	947
BseXI	GCAGC	3 cut(s)	207, 627, 712
BseYI	CCCAGC	1 cut(s)	1048
Bsh1285I	CGRYCG	2 cut(s)	835, 947
BshNI	GGYRCC	1 cut(s)	1106
BsiEI	CGRYCG	2 cut(s)	835, 947
BsiHKCI	CYCGRG	2 cut(s)	884, 996
BsiSI	CCGG	1 cut(s)	912
BslFI	GGGAC	2 cut(s)	894, 1006
BslI	CCNNNNNNNGG	2 cut(s)	855, 967
BsmFI	GGGAC	2 cut(s)	894, 1006
BsoBI	CYCGRG	2 cut(s)	884, 996
Bsp143I	GATC	4 cut(s)	541, 705, 832, 944
BspACI	CCGC	8 cut(s)	164, 502, 583, 846, 895, 898, 1007, 1010
BspCNI	CTCAG	3 cut(s)	4, 456, 472
BspHI	TCATGA	1 cut(s)	46
BspLI	GGNNCC	1 cut(s)	1108
BspMAI	CTGCAG	2 cut(s)	515, 596
BspT107I	GGYRCC	1 cut(s)	1106
BsrI	ACTGG	3 cut(s)	112, 191, 318
BssECI	CCNNGG	1 cut(s)	83
BssMI	GATC	4 cut(s)	541, 705, 832, 944
BssNI	GRCGYC	2 cut(s)	838, 950
Bst2UI	CCWGG	3 cut(s)	85, 856, 968
BstACI	GRCGYC	2 cut(s)	838, 950
BstC8I	GCNNGC	2 cut(s)	515, 596
BstDEI	CTNAG	4 cut(s)	12, 93, 459, 464
BstF5I	GGATG	6 cut(s)	67, 250, 401, 447, 544, 697
BstHHI	GCGC	2 cut(s)	738, 1092
BstKTI	GATC	4 cut(s)	544, 708, 835, 947
BstMBI	GATC	4 cut(s)	541, 705, 832, 944
BstMCI	CGRYCG	2 cut(s)	835, 947
BstMWI	GCNNNNNNNGC	1 cut(s)	752
BstNI	CCWGG	3 cut(s)	85, 856, 968
BstSCI	CCNGG	4 cut(s)	83, 854, 910, 966
BstSFI	CTRYAG	5 cut(s)	143, 255, 511, 592, 1118
BstV1I	GCAGC	3 cut(s)	207, 627, 712
BstV2I	GAAGAC	1 cut(s)	338
BsuI	GTATCC	1 cut(s)	393
BtsCI	GGATG	6 cut(s)	67, 250, 401, 447, 544, 697
BtsIMutI	CAGTG	3 cut(s)	184, 708, 708
Cac8I	GCNNGC	2 cut(s)	515, 596
CciI	TCATGA	1 cut(s)	46
CfoI	GCGC	2 cut(s)	738, 1092
CseI	GACGC	2 cut(s)	846, 958
CsiI	ACCWGGT	2 cut(s)	854, 966
Csp6I	GTAC	6 cut(s)	508, 589, 765, 859, 971, 1114
CviAII	CATG	5 cut(s)	47, 362, 475, 535, 556
CviQI	GTAC	6 cut(s)	508, 589, 765, 859, 971, 1114
DdeI	CTNAG	4 cut(s)	12, 93, 459, 464
DpnI	GATC	4 cut(s)	543, 707, 834, 946
DpnII	GATC	4 cut(s)	541, 705, 832, 944
EciI	GGCGGA	1 cut(s)	835
Eco57I	CTGAAG	1 cut(s)	332
Eco88I	CYCGRG	2 cut(s)	884, 996
EcoRII	CCWGG	3 cut(s)	83, 854, 966
FaeI	CATG	5 cut(s)	50, 365, 478, 538, 559
FalI	AAGNNNNNCTT	2 cut(s)	776, 808
FaqI	GGGAC	2 cut(s)	894, 1006
FatI	CATG	5 cut(s)	46, 361, 474, 534, 555
FauNDI	CATATG	1 cut(s)	394
FbaI	TGATCA	2 cut(s)	541, 705
FblI	GTMKAC	1 cut(s)	142
Fnu4HI	GCNGC	5 cut(s)	221, 616, 726, 898, 1010
FokI	GGATG	6 cut(s)	74, 237, 388, 434, 551, 704
Fsp4HI	GCNGC	5 cut(s)	221, 616, 726, 898, 1010
FspBI	CTAG	7 cut(s)	5, 27, 297, 339, 485, 566, 756
GlaI	GCGC	2 cut(s)	737, 1091
GluI	GCNGC	5 cut(s)	221, 616, 726, 898, 1010
GsaI	CCCAGC	1 cut(s)	1052
HapII	CCGG	1 cut(s)	912
HgaI	GACGC	2 cut(s)	846, 958
HhaI	GCGC	2 cut(s)	738, 1092
Hin1I	GRCGYC	2 cut(s)	838, 950
Hin1II	CATG	5 cut(s)	50, 365, 478, 538, 559
Hin6I	GCGC	2 cut(s)	736, 1090
HinP1I	GCGC	2 cut(s)	736, 1090
HinfI	GANTC	6 cut(s)	343, 809, 815, 827, 920, 939
HpaII	CCGG	1 cut(s)	912
HphI	GGTGA	4 cut(s)	30, 844, 926, 956
Hpy166II	GTNNAC	4 cut(s)	143, 472, 553, 789
Hpy188I	TCNGA	7 cut(s)	198, 310, 546, 814, 820, 832, 944
Hpy188III	TCNNGA	7 cut(s)	47, 157, 434, 884, 886, 996, 998
Hpy8I	GTNNAC	4 cut(s)	143, 472, 553, 789
Hpy99I	CGWCG	2 cut(s)	840, 952
HpyAV	CCTTC	3 cut(s)	51, 316, 802
HpyCH4IV	ACGT	4 cut(s)	651, 671, 763, 1063
HpyCH4V	TGCA	5 cut(s)	223, 513, 594, 658, 728
HpyF10VI	GCNNNNNNNGC	1 cut(s)	752
HpyF3I	CTNAG	4 cut(s)	12, 93, 459, 464
HpySE526I	ACGT	4 cut(s)	651, 671, 763, 1063
Hsp92I	GRCGYC	2 cut(s)	838, 950
Hsp92II	CATG	5 cut(s)	50, 365, 478, 538, 559
HspAI	GCGC	2 cut(s)	736, 1090
Ksp22I	TGATCA	2 cut(s)	541, 705
Kzo9I	GATC	4 cut(s)	541, 705, 832, 944
LmnI	GCTCC	1 cut(s)	637
Lsp1109I	GCAGC	3 cut(s)	207, 627, 712
LweI	GCATC	1 cut(s)	672
MabI	ACCWGGT	2 cut(s)	854, 966
MaeI	CTAG	7 cut(s)	5, 27, 297, 339, 485, 566, 756
MaeII	ACGT	4 cut(s)	651, 671, 763, 1063
MaeIII	GTNAC	6 cut(s)	36, 103, 672, 850, 914, 962
MalI	GATC	4 cut(s)	543, 707, 834, 946
MboI	GATC	4 cut(s)	541, 705, 832, 944
MboII	GAAGA	3 cut(s)	71, 281, 338
MluCI	AATT	6 cut(s)	99, 437, 713, 903, 1015, 1036
MlyI	GAGTC	1 cut(s)	352
MmeI	TCCRAC	3 cut(s)	653, 1012, 1038
MroXI	GAANNNNTTC	1 cut(s)	332
MseI	TTAA	4 cut(s)	648, 902, 1014, 1041
MslI	CAYNNNNRTG	1 cut(s)	360
MspA1I	CMGCKG	2 cut(s)	463, 679
MspI	CCGG	1 cut(s)	912
MspR9I	CCNGG	4 cut(s)	85, 856, 912, 968
MvaI	CCWGG	3 cut(s)	85, 856, 968
MwoI	GCNNNNNNNGC	1 cut(s)	752
NciI	CCSGG	1 cut(s)	912
NdeI	CATATG	1 cut(s)	394
NdeII	GATC	4 cut(s)	541, 705, 832, 944
NlaIII	CATG	5 cut(s)	50, 365, 478, 538, 559
NlaIV	GGNNCC	1 cut(s)	1108
NmeAIII	GCCGAG	1 cut(s)	772
NmuCI	GTSAC	5 cut(s)	36, 672, 850, 914, 962
PaeR7I	CTCGAG	2 cut(s)	884, 996
PagI	TCATGA	1 cut(s)	46
PcsI	WCGNNNNNNNCGW	2 cut(s)	769, 1069
PdmI	GAANNNNTTC	1 cut(s)	332
PfeI	GAWTC	5 cut(s)	809, 815, 827, 920, 939
PkrI	GCNGC	5 cut(s)	222, 617, 727, 899, 1011
Ple19I	CGATCG	2 cut(s)	835, 947
PleI	GAGTC	1 cut(s)	351
PpsI	GAGTC	1 cut(s)	351
Psp1406I	AACGTT	1 cut(s)	651
Psp6I	CCWGG	3 cut(s)	83, 854, 966
PspFI	CCCAGC	1 cut(s)	1048
PspGI	CCWGG	3 cut(s)	83, 854, 966
PspN4I	GGNNCC	1 cut(s)	1108
PstI	CTGCAG	2 cut(s)	515, 596
PvuI	CGATCG	2 cut(s)	835, 947
PvuII	CAGCTG	2 cut(s)	463, 679
RsaI	GTAC	6 cut(s)	509, 590, 766, 860, 972, 1115
RsaNI	GTAC	6 cut(s)	508, 589, 765, 859, 971, 1114
RseI	CAYNNNNRTG	1 cut(s)	360
SaqAI	TTAA	4 cut(s)	648, 902, 1014, 1041
SatI	GCNGC	5 cut(s)	221, 616, 726, 898, 1010
Sau3AI	GATC	4 cut(s)	541, 705, 832, 944
SchI	GAGTC	1 cut(s)	352
ScrFI	CCNGG	4 cut(s)	85, 856, 912, 968
SexAI	ACCWGGT	2 cut(s)	854, 966
SfaNI	GCATC	1 cut(s)	672
SfcI	CTRYAG	5 cut(s)	143, 255, 511, 592, 1118
Sfr274I	CTCGAG	2 cut(s)	884, 996
SlaI	CTCGAG	2 cut(s)	884, 996
SmiMI	CAYNNNNRTG	1 cut(s)	360
SmlI	CTYRAG	2 cut(s)	884, 996
SmoI	CTYRAG	2 cut(s)	884, 996
Sse9I	AATT	6 cut(s)	99, 437, 713, 903, 1015, 1036
SsiI	CCGC	8 cut(s)	164, 502, 583, 846, 895, 898, 1007, 1010
SspMI	CTAG	7 cut(s)	5, 27, 297, 339, 485, 566, 756
StyD4I	CCNGG	4 cut(s)	83, 854, 910, 966
TaiI	ACGT	4 cut(s)	654, 674, 766, 1066
TaqI	TCGA	8 cut(s)	276, 413, 825, 835, 885, 937, 947, 997
TasI	AATT	6 cut(s)	99, 437, 713, 903, 1015, 1036
TauI	GCSGC	2 cut(s)	900, 1012
TfiI	GAWTC	5 cut(s)	809, 815, 827, 920, 939
Tru1I	TTAA	4 cut(s)	648, 902, 1014, 1041
Tru9I	TTAA	4 cut(s)	648, 902, 1014, 1041
TscAI	CASTG	3 cut(s)	191, 708, 715
TseFI	GTSAC	5 cut(s)	36, 672, 850, 914, 962
TseI	GCWGC	3 cut(s)	220, 615, 725
Tsp45I	GTSAC	5 cut(s)	36, 672, 850, 914, 962
TspDTI	ATGAA	1 cut(s)	912
TspGWI	ACGGA	1 cut(s)	950
TspRI	CASTG	3 cut(s)	191, 708, 715
XapI	RAATTY	3 cut(s)	437, 713, 1036
XhoI	CTCGAG	2 cut(s)	884, 996
XmiI	GTMKAC	1 cut(s)	142
XmnI	GAANNNNTTC	1 cut(s)	332
XspI	CTAG	7 cut(s)	5, 27, 297, 339, 485, 566, 756

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.